February 26, 2021

Rhod-4, AM

Rhod-4, AM 

To Order Contact us: bjorn@lembcke.dk

Rhod-4™, AM

21123 20x50 ug
EUR 480
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Rhod-FF, AM

21077 1 mg
EUR 306
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Rhod-FF, AM

21078 10x50 ug
EUR 219
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Rhod-2 AM

HY-D0989 1mg
EUR 436

Rhod-2, AM ester

50024 1MG
EUR 230
Description: Minimum order quantity: 1 unit of 1MG

Rhod-2, AM ester: (10x100ug)

50023 10ST
EUR 259
Description: Minimum order quantity: 1 unit of 10ST

Rhod-590 AM ester, 50ug

50025 50uG
EUR 362
Description: Minimum order quantity: 1 unit of 50uG

Rhod-2, AM *CAS#: 145037-81-6*

21060 1 mg
EUR 202
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Fluo-4 AM

HY-101896 100ug
EUR 546

Rhod-2, AM *UltraPure Grade* *CAS#: 145037-81-6*

21062 1 mg
EUR 219
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Rhod-2, AM *UltraPure Grade* *CAS#: 145037-81-6*

21063 50 mg
EUR 4356
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Rhod-2, AM *UltraPure Grade* *CAS#: 145037-81-6*

21064 20x50 ug
EUR 263
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Mag-Fluo-4 AM

20401 10x50 ug
EUR 176
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Rhod-4™, sodium salt

21118 1 mg
EUR 480
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Rhod-4™, potassium salt

21119 1 mg
EUR 480
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Rhod-4™, sodium salt

21128 5x50 ug
EUR 306
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Rhod-4™, potassium salt

21129 5x50 ug
EUR 306
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Fluo-4, AM ester, 50ug

50018 10ST
EUR 275
Description: Minimum order quantity: 1 unit of 10ST

RHOD Antibody

35000-100ul 100ul
EUR 252

RHOD Antibody

35000-50ul 50ul
EUR 187

RHOD antibody

38940-100ul 100ul
EUR 252

RHOD antibody

10R-5622 100 ul
EUR 726
Description: Mouse monoclonal RHOD antibody

RHOD Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RHOD. Recognizes RHOD from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

RHOD Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RHOD. Recognizes RHOD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RHOD Antibody

CSB-PA945646-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RHOD. Recognizes RHOD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RHOD Antibody

DF4439 200ul
EUR 304
Description: RHOD Antibody detects endogenous levels of total RHOD.

RhoD antibody

70R-50968 100 ul
EUR 244
Description: Purified Polyclonal RhoD antibody

RHOD antibody

70R-5765 50 ug
EUR 467
Description: Rabbit polyclonal RHOD antibody raised against the N terminal of RHOD

RHOD antibody

70R-5766 50 ug
EUR 467
Description: Rabbit polyclonal RHOD antibody raised against the C terminal of RHOD

RHOD Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHOD. Recognizes RHOD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RHOD Antibody

ABD4439 100 ug
EUR 438


20300 1 mg
EUR 50
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200


EUR 262


EUR 109


20997 2X50 ug
EUR 306
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200


20998 250 ug
EUR 393
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200


21000 1 mg
EUR 876
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200


21202 1 mg
EUR 176
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Calcein AM

EUR 370

Calcein AM

EUR 327

Calcein AM

EUR 131


EUR 153


EUR 430


B4758-10 10 mg
EUR 128
Description: BAPTA-AM is a selective calcium chelator [1]. Ca2+ is one of the most ubiquitous and versatile intracellular signaling molecules that control numerous cellular processes such as neurotransmitter release, contraction of all muscle cell types and fertilization [4].


B4758-5.1 10 mM (in 1mL DMSO)
EUR 142
Description: BAPTA-AM is a selective calcium chelator [1]. Ca2+ is one of the most ubiquitous and versatile intracellular signaling molecules that control numerous cellular processes such as neurotransmitter release, contraction of all muscle cell types and fertilization [4].


B4758-50 50 mg
EUR 325
Description: BAPTA-AM is a selective calcium chelator [1]. Ca2+ is one of the most ubiquitous and versatile intracellular signaling molecules that control numerous cellular processes such as neurotransmitter release, contraction of all muscle cell types and fertilization [4].


B5370-1 1 mg
EUR 160


B5370-25 25 mg
EUR 2111


B5370-5 5 mg
EUR 545


EUR 588


EUR 185

AM resin

  • EUR 314.00
  • EUR 592.00
  • EUR 885.00
  • 100 g
  • 250 g
  • 500 g
  • Shipped within 5-10 working days.

AM 281

B6603-10 10 mg
EUR 195
Description: AM 281 is a potent and selective antagonist/inverse agonist of CB1 cannabinoid receptor with Ki values of 12 and 4200 nM for CB1 and CB2 receptors, respectively [1].CB1 cannabinoid receptor is a G protein-coupled receptor and is mainly expressed in the brain.

AM 281

B6603-5 5 mg
EUR 125
Description: AM 281 is a potent and selective antagonist/inverse agonist of CB1 cannabinoid receptor with Ki values of 12 and 4200 nM for CB1 and CB2 receptors, respectively [1].CB1 cannabinoid receptor is a G protein-coupled receptor and is mainly expressed in the brain.

AM 281

B6603-50 50 mg
EUR 635
Description: AM 281 is a potent and selective antagonist/inverse agonist of CB1 cannabinoid receptor with Ki values of 12 and 4200 nM for CB1 and CB2 receptors, respectively [1].CB1 cannabinoid receptor is a G protein-coupled receptor and is mainly expressed in the brain.

AM 404

B6604-100 100 mg
EUR 419
Description: AM 404 is a selective inhibitor of anandamide transport [1]. Also, it is an agonist of CB1 cannabinoid receptor and potential vanilloid type 1 (TRPV1).

AM 404

B6604-50 50 mg
EUR 261
Description: AM 404 is a selective inhibitor of anandamide transport [1]. Also, it is an agonist of CB1 cannabinoid receptor and potential vanilloid type 1 (TRPV1).

AM 1172

B7392-10 10 mg
EUR 235
Description: AM 1172 is a potent and selective inhibitor of stable anandamide uptake with IC50 of 2.43102.5 ?M and fatty acid amide hydrolase (FAAH) with Ki of 3.18 ?M. FAAH, is an integral membrane hydrolase that hydrolyzes bioactive amides.

AM 1172

B7392-100 100 mg
EUR 1414
Description: AM 1172 is a potent and selective inhibitor of stable anandamide uptake with IC50 of 2.43102.5 ?M and fatty acid amide hydrolase (FAAH) with Ki of 3.18 ?M. FAAH, is an integral membrane hydrolase that hydrolyzes bioactive amides.

AM 1172

B7392-5 5 mg
EUR 147
Description: AM 1172 is a potent and selective inhibitor of stable anandamide uptake with IC50 of 2.43102.5 ?M and fatty acid amide hydrolase (FAAH) with Ki of 3.18 ?M. FAAH, is an integral membrane hydrolase that hydrolyzes bioactive amides.

AM 1172

B7392-50 50 mg
EUR 830
Description: AM 1172 is a potent and selective inhibitor of stable anandamide uptake with IC50 of 2.43102.5 ?M and fatty acid amide hydrolase (FAAH) with Ki of 3.18 ?M. FAAH, is an integral membrane hydrolase that hydrolyzes bioactive amides.

AM 114

A8163-10 10 mg
EUR 119
Description: AM 114, a derivative of boronic chalcone, is a potent small-molecule inhibitor of the proteasome that inhibits the chymotrypsin-like activity of the 20S proteasome, with a value of 50% inhibition concentration IC50 of approximately 1 ?M

AM 114

A8163-25 25 mg
EUR 189
Description: AM 114, a derivative of boronic chalcone, is a potent small-molecule inhibitor of the proteasome that inhibits the chymotrypsin-like activity of the 20S proteasome, with a value of 50% inhibition concentration IC50 of approximately 1 ?M

AM 114

A8163-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: AM 114, a derivative of boronic chalcone, is a potent small-molecule inhibitor of the proteasome that inhibits the chymotrypsin-like activity of the 20S proteasome, with a value of 50% inhibition concentration IC50 of approximately 1 ?M

AM 114

A8163-50 50 mg
EUR 282
Description: AM 114, a derivative of boronic chalcone, is a potent small-molecule inhibitor of the proteasome that inhibits the chymotrypsin-like activity of the 20S proteasome, with a value of 50% inhibition concentration IC50 of approximately 1 ?M

AM 114

A8163-S Evaluation Sample
EUR 81
Description: AM 114, a derivative of boronic chalcone, is a potent small-molecule inhibitor of the proteasome that inhibits the chymotrypsin-like activity of the 20S proteasome, with a value of 50% inhibition concentration IC50 of approximately 1 ?M


HY-100221 10mM/1mL
EUR 216


HY-100545 50mg
EUR 436


HY-12585 5mg
EUR 371


HY-13467 5mg
EUR 452

AM 103

HY-14163 1mg
EUR 2254


HY-D0041 100ug
EUR 147


HY-D0973 5mg
EUR 587


HY-100727 10mM/1mL
EUR 361


HY-101883 1mg
EUR 316


HY-108329 100mg
EUR 1153


HY-108715A 1mg
EUR 452


GK8201-1MG 1 mg
EUR 628


GT0291-1MG 1 mg
EUR 341


B2718-25 25 mg
EUR 510


B2718-5 5 mg
EUR 166

IL-4 Interleukin 4 Human Recombinant Protein, Yeast

PROTP05112-4 Regular: 10ug
EUR 317
Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques.

RHOD Blocking Peptide

33R-8964 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RHOD antibody, catalog no. 70R-5765

RHOD Blocking Peptide

33R-6707 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RHOD antibody, catalog no. 70R-5766

Polyclonal RhoD Antibody

AMM07606G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RhoD . This antibody is tested and proven to work in the following applications:

RHOD Blocking Peptide

DF4439-BP 1mg
EUR 195

RHOD Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RHOD Conjugated Antibody

C38940 100ul
EUR 397

RHOD cloning plasmid

CSB-CL019688HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 633
  • Sequence: atgacggcggcccaggccgcgggtgaggaggcgccaccaggcgtgcggtccgtcaaggtggtcctggtgggcgacggcggctgcgggaagacgtcgctgctgatggtcttcgccgatggggccttccccgagagctacacccccacggtgtttgagcggtacatggtcaacctgca
  • Show more
Description: A cloning plasmid for the RHOD gene.

RHOD Polyclonal Antibody

A68691 100 ?g
EUR 628.55
Description: reagents widely cited

RHOD Rabbit pAb

A6463-100ul 100 ul
EUR 308

RHOD Rabbit pAb

A6463-200ul 200 ul
EUR 459

RHOD Rabbit pAb

A6463-20ul 20 ul
EUR 183

RHOD Rabbit pAb

A6463-50ul 50 ul
EUR 223

RHOD Rabbit pAb

A17399-100ul 100 ul Ask for price

RHOD Rabbit pAb

A17399-200ul 200 ul Ask for price

RHOD Rabbit pAb

A17399-20ul 20 ul Ask for price

RHOD Rabbit pAb

A17399-50ul 50 ul
EUR 384


PVT12736 2 ug
EUR 391

Anti-RHOD antibody

STJ28546 100 µl
EUR 277
Description: Ras homolog, or Rho, proteins interact with protein kinases and may serve as targets for activated GTPase. They play a critical role in muscle differentiation. The protein encoded by this gene binds GTP and is a member of the small GTPase superfamily. It is involved in endosome dynamics and reorganization of the actin cytoskeleton, and it may coordinate membrane transport with the function of the cytoskeleton. Two transcript variants encoding different isoforms have been found for this gene.

Anti-RHOD antibody

STJ119521 50 µl
EUR 393
Description: Ras homolog, or Rho, proteins interact with protein kinases and may serve as targets for activated GTPase. They play a critical role in muscle differentiation. The protein encoded by this gene binds GTP and is a member of the small GTPase superfamily. It is involved in endosome dynamics and reorganization of the actin cytoskeleton, and it may coordinate membrane transport with the function of the cytoskeleton. Two transcript variants encoding different isoforms have been found for this gene.

Anti-RHOD (1E7)

YF-MA18289 100 ug
EUR 363
Description: Mouse monoclonal to RHOD

Individual Reaction Mix 4

G065-4 200 reactions
EUR 167

Fluo-2, AM

20494 10x50 ug
EUR 176
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Fluo-2, AM

20495 1 mg
EUR 219
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200


EUR 262


EUR 153

BAPTA, AM ester

50000 25MG
EUR 205
Description: Minimum order quantity: 1 unit of 25MG

BAPTA, AM ester

50000-1 20MG
EUR 243
Description: Minimum order quantity: 1 unit of 20MG

BCECF, AM ester

51012 1MG
EUR 137
Description: Minimum order quantity: 1 unit of 1MG

AM-92016 Hydrochloride

EUR 631

AM-92016 Hydrochloride

EUR 196

AM-095 Sodium

EUR 631

AM 92016 hydrochloride

B6482-10 10 mg
EUR 318
Description: AM 92016 hydrochloride is a specific inhibitor of delayed rectifier potassium current [1]. Potassium channel is an ion channel and acts to reset the resting potential and shapes the action potential.

Calcein AM, (20x50ug)

80011-3 20ST
EUR 242
Description: Minimum order quantity: 1 unit of 20ST


EUR 131


EUR 349


EUR 137


EUR 398

AM-92016 (hydrochloride)

HY-101253 10mM/1mL
EUR 176

Fura-2 AM

HY-101897 1mg
EUR 408

Indo-1 AM

HY-101898 1mg
EUR 366

Rhod-4, AM