May 10, 2021

POSTN sgRNA CRISPR/Cas9 All-in-one

POSTN sgRNA CRISPR/Cas9 All-in-one 

To Order Contact us: bjorn@lembcke.dk

POSTN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1689006 1.0 ug DNA
EUR 167

POSTN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1689007 1.0 ug DNA
EUR 167

POSTN sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1689008 1.0 ug DNA
EUR 167

Postn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4381706 1.0 ug DNA
EUR 167

Postn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4381707 1.0 ug DNA
EUR 167

Postn sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4381708 1.0 ug DNA
EUR 167

Postn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6220506 1.0 ug DNA
EUR 167

Postn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6220507 1.0 ug DNA
EUR 167

Postn sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6220508 1.0 ug DNA
EUR 167

Human Periostin (POSTN) ELISA Kit
DLR-POSTN-Hu-48T 48T
EUR 517
  • Should the Human Periostin (POSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Periostin (POSTN) in samples from serum, plasma or other biological fluids.

Human Periostin (POSTN) ELISA Kit
DLR-POSTN-Hu-96T 96T
EUR 673
  • Should the Human Periostin (POSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Periostin (POSTN) in samples from serum, plasma or other biological fluids.

Mouse Periostin (POSTN) ELISA Kit
DLR-POSTN-Mu-48T 48T
EUR 527
  • Should the Mouse Periostin (POSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Periostin (POSTN) in samples from serum, plasma or other biological fluids.

Mouse Periostin (POSTN) ELISA Kit
DLR-POSTN-Mu-96T 96T
EUR 688
  • Should the Mouse Periostin (POSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Periostin (POSTN) in samples from serum, plasma or other biological fluids.

Rat Periostin (POSTN) ELISA Kit
DLR-POSTN-Ra-48T 48T
EUR 549
  • Should the Rat Periostin (POSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Periostin (POSTN) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Periostin (POSTN) ELISA Kit
DLR-POSTN-Ra-96T 96T
EUR 718
  • Should the Rat Periostin (POSTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Periostin (POSTN) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Periostin (POSTN) ELISA Kit
RD-POSTN-Hu-48Tests 48 Tests
EUR 521

Human Periostin (POSTN) ELISA Kit
RD-POSTN-Hu-96Tests 96 Tests
EUR 723

Mouse Periostin (POSTN) ELISA Kit
RD-POSTN-Mu-48Tests 48 Tests
EUR 533

Mouse Periostin (POSTN) ELISA Kit
RD-POSTN-Mu-96Tests 96 Tests
EUR 740

Rat Periostin (POSTN) ELISA Kit
RD-POSTN-Ra-48Tests 48 Tests
EUR 557

Rat Periostin (POSTN) ELISA Kit
RD-POSTN-Ra-96Tests 96 Tests
EUR 775

Human Periostin (POSTN) ELISA Kit
RDR-POSTN-Hu-48Tests 48 Tests
EUR 544

Human Periostin (POSTN) ELISA Kit
RDR-POSTN-Hu-96Tests 96 Tests
EUR 756

Mouse Periostin (POSTN) ELISA Kit
RDR-POSTN-Mu-48Tests 48 Tests
EUR 557

Mouse Periostin (POSTN) ELISA Kit
RDR-POSTN-Mu-96Tests 96 Tests
EUR 774

Rat Periostin (POSTN) ELISA Kit
RDR-POSTN-Ra-48Tests 48 Tests
EUR 583

Rat Periostin (POSTN) ELISA Kit
RDR-POSTN-Ra-96Tests 96 Tests
EUR 811

Leukemia - ALL Exosome
P141-ALL NULL
EUR 0

Leukemia - ALL Exosome RNA
P241-ALL NULL
EUR 0

POSTN sgRNA CRISPR Lentivector set (Human)
K1689001 3 x 1.0 ug
EUR 339

Postn sgRNA CRISPR Lentivector set (Mouse)
K4381701 3 x 1.0 ug
EUR 339

Postn sgRNA CRISPR Lentivector set (Rat)
K6220501 3 x 1.0 ug
EUR 339

POSTN siRNA
20-abx929284
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

POSTN siRNA
20-abx929285
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

POSTN antibody
70R-6066 50 ug
EUR 467
Description: Rabbit polyclonal POSTN antibody raised against the N terminal of POSTN

POSTN antibody
70R-6070 50 ug
EUR 467
Description: Rabbit polyclonal POSTN antibody raised against the middle region of POSTN

POSTN Antibody
ABD6746 100 ug
EUR 438

POSTN antibody
38331-100ul 100ul
EUR 252

POSTN antibody
10R-5369 100 ul
EUR 726
Description: Mouse monoclonal POSTN antibody

POSTN antibody
70R-19425 50 ul
EUR 435
Description: Rabbit polyclonal POSTN antibody

POSTN antibody
70R-15043 100 ul
EUR 392
Description: Rabbit polyclonal POSTN antibody

POSTN antibody
70R-15044 100 ul
EUR 392
Description: Rabbit polyclonal POSTN antibody

POSTN Antibody
DF6746 200ul
EUR 304
Description: POSTN Antibody detects endogenous levels of total POSTN.

POSTN Antibody
1-CSB-PA619962ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against POSTN. Recognizes POSTN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Postn Antibody
CSB-PA202817-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against Postn. Recognizes Postn from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Postn Antibody
CSB-PA202817-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against Postn. Recognizes Postn from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

POSTN Antibody
1-CSB-PA09905A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against POSTN. Recognizes POSTN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

POSTN Antibody
1-CSB-PA018381GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against POSTN. Recognizes POSTN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Scrambled sgRNA CRISPR/Cas9 All-in-One Lentivector
K010 1.0 ug
EUR 154

POSTN sgRNA CRISPR Lentivector (Human) (Target 1)
K1689002 1.0 ug DNA
EUR 154

POSTN sgRNA CRISPR Lentivector (Human) (Target 2)
K1689003 1.0 ug DNA
EUR 154

POSTN sgRNA CRISPR Lentivector (Human) (Target 3)
K1689004 1.0 ug DNA
EUR 154

Postn sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4381702 1.0 ug DNA
EUR 154

Postn sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4381703 1.0 ug DNA
EUR 154

Postn sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4381704 1.0 ug DNA
EUR 154

Postn sgRNA CRISPR Lentivector (Rat) (Target 1)
K6220502 1.0 ug DNA
EUR 154

Postn sgRNA CRISPR Lentivector (Rat) (Target 2)
K6220503 1.0 ug DNA
EUR 154

Postn sgRNA CRISPR Lentivector (Rat) (Target 3)
K6220504 1.0 ug DNA
EUR 154

Cas9 monoclonal antibody [Clone 7A9]
CAS9-AB-2 25 ug
EUR 204
  • Category: Cas9

TDOR sgRNA CRISPR/Cas9 All-in-One Lentivector set ()
K9000805 3 x 1.0 ug
EUR 376

POSTN Conjugated Antibody
C38331 100ul
EUR 397

POSTN Polyclonal Antibody
ES11309-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against POSTN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

POSTN Polyclonal Antibody
ES11309-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against POSTN from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Periostin (POSTN) Antibody
20-abx130227
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

POSTN Polyclonal Antibody
ABP59973-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human POSTN protein
  • Applications tips:
Description: A polyclonal antibody for detection of POSTN from Human, Mouse. This POSTN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human POSTN protein

POSTN Polyclonal Antibody
ABP59973-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human POSTN protein
  • Applications tips:
Description: A polyclonal antibody for detection of POSTN from Human, Mouse. This POSTN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human POSTN protein

POSTN Polyclonal Antibody
ABP59973-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human POSTN protein
  • Applications tips:
Description: A polyclonal antibody for detection of POSTN from Human, Mouse. This POSTN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human POSTN protein

Periostin (POSTN) Antibody
20-abx001628
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Periostin (POSTN) Antibody
abx037124-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Periostin (POSTN) Antibody
20-abx100627
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Periostin (POSTN) Antibody
20-abx100628
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Periostin (POSTN) Antibody
20-abx100629
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Periostin (POSTN) Antibody
20-abx100630
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Periostin (POSTN) Antibody
20-abx100631
  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Periostin (POSTN) Antibody
20-abx100632
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Periostin (POSTN) Antibody
abx026531-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Periostin (POSTN) Antibody
abx026531-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Periostin (POSTN) Antibody
20-abx320356
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Periostin (POSTN) Antibody
abx332108-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

POSTN Polyclonal Antibody
A54348 100 µg
EUR 570.55
Description: kits suitable for this type of research

POSTN Rabbit pAb
A2003-100ul 100 ul
EUR 308

POSTN Rabbit pAb
A2003-200ul 200 ul
EUR 459

POSTN Rabbit pAb
A2003-20ul 20 ul
EUR 183

POSTN Rabbit pAb
A2003-50ul 50 ul
EUR 223

POSTN Rabbit pAb
A14556-100ul 100 ul
EUR 308

POSTN Rabbit pAb
A14556-200ul 200 ul
EUR 459

POSTN Rabbit pAb
A14556-20ul 20 ul
EUR 183

POSTN Rabbit pAb
A14556-50ul 50 ul
EUR 223

POSTN Blocking Peptide
33R-9848 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POSTN antibody, catalog no. 70R-6070

POSTN Blocking Peptide
33R-7797 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POSTN antibody, catalog no. 70R-6066

POSTN Blocking Peptide
DF6746-BP 1mg
EUR 195

POSTN cloning plasmid
CSB-CL619962HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2340
  • Sequence: ATGATTCCCTTTTTACCCATGTTTTCTCTACTATTGCTGCTTATTGTTAACCCTATAAACGCCAACAATCATTATGACAAGATCTTGGCTCATAGTCGTATCAGGGGTCGGGACCAAGGCCCAAATGTCTGTGCCCTTCAACAGATTTTGGGCACCAAAAAGAAATACTTCAGCA
  • Show more
Description: A cloning plasmid for the POSTN gene.

Recombinant Periostin (POSTN)
4-RPH339Hu01
  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15063
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.2kDa
  • Isoelectric Point: 6.6
Description: Recombinant Human Periostin expressed in: E.coli

Recombinant Periostin (POSTN)
4-RPH339Hu02
  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15063
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Periostin expressed in: E.coli

Recombinant Periostin (POSTN)
4-RPH339Mu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q62009
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.9kDa
  • Isoelectric Point: 6.3
Description: Recombinant Mouse Periostin expressed in: E.coli

Recombinant Periostin (POSTN)
4-RPH339Mu02
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q62009
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.3kDa
  • Isoelectric Point: 7.9
Description: Recombinant Mouse Periostin expressed in: E.coli

Recombinant Periostin (POSTN)
4-RPH339Ra01
  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D3ZAF5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.4kDa
  • Isoelectric Point: 7.7
Description: Recombinant Rat Periostin expressed in: E.coli

Recombinant Periostin (POSTN)
4-RPH339Ra02
  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D3ZAF5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Periostin expressed in: E.coli

Anti-POSTN antibody
STJ26193 100 µl
EUR 277
Description: This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing, and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-POSTN antibody
STJ116767 100 µl
EUR 277
Description: This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing, and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-POSTN antibody
STJ192467 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to POSTN

A549 / Cas9 (Puro) Stable Cell Line
SC043-Cas9-Puro 2 x 106 cell/ml x 1ml
EUR 1058
Description: Cas9 expression stable cell line with Puromycin marker in A549 human lung cancer cells.

Hela / Cas9 (Bad) Stable Cell Line
SC045-Cas9-Bsd 2 x 106 cell/ml x 1ml
EUR 1058
Description: Cas9 expression stable cell line with Blasticidin resistance in Hela human cervical cancer cells.

2019-nCoV IgG/IgM Rapid Test Cassette (Whole Blood/Serum/Plasma)
GEN-402-25tests 25 tests
EUR 244
Description: A rapid test for detection of antibodies (IgG and IgM) for 2019-nCoV, the novel Coronavirus from the Wuhan strain. The test is easy to perform, takes 10 minutes to provide reliable results and is higly specific to the 2019-nCoV Coronavirus.

A549 / Cas9 (GFP-Puro) Stable Cell Line
SC043-Cas9-GP 2 x 106 cell/ml x 1ml
EUR 1500
Description: Cas9 expression stable cell line with GFP-Puromycin fusion dual marker in A549 human lung cancer cells.

A549 / Cas9 (RFP-Puro) Stable Cell Line
SC043-Cas9-RP 2 x 106 cell/ml x 1ml
EUR 1500
Description: Cas9 expression stable cell line with RFP-Puromycin fusion dual marker in A549 human lung cancer cells.

DUX4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0000105 3 x 1.0 ug
EUR 376

CLCA2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0000205 3 x 1.0 ug
EUR 376

CD74 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0000305 3 x 1.0 ug
EUR 376

KIAA sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0000605 3 x 1.0 ug
EUR 376

ADIPOR1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0000705 3 x 1.0 ug
EUR 376

SHIP1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0000805 3 x 1.0 ug
EUR 376

LRBA sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0000905 3 x 1.0 ug
EUR 376

RIC sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0001005 3 x 1.0 ug
EUR 376

MTOR sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0001105 3 x 1.0 ug
EUR 376

Sin1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0001205 3 x 1.0 ug
EUR 376

CXCR6 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0001305 3 x 1.0 ug
EUR 376

POSTN sgRNA CRISPR/Cas9 All-in-one