May 14, 2021

NLRP1 antibody, 50ug

NLRP1 antibody, 50ug 

To Order Contact us:

NLRP1 Antibody

43280-100ul 100ul
EUR 252

NLRP1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLRP1. Recognizes NLRP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-200

NLRP1 Antibody

DF13187 200ul
EUR 304
Description: NLRP1 Antibody detects endogenous levels of NLRP1.

NLRP1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NLRP1. Recognizes NLRP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

NLRP1 Conjugated Antibody

C43280 100ul
EUR 397

NLRP1 Polyclonal Antibody

A67466 100 µg
EUR 570.55
Description: Ask the seller for details

anti- NLRP1 antibody

FNab05757 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: NLR family, pyrin domain containing 1
  • Uniprot ID: Q9C000
  • Gene ID: 22861
  • Research Area: Immunology
Description: Antibody raised against NLRP1

Anti-NLRP1 antibody

PAab05757 100 ug
EUR 412

Anti-NLRP1 antibody

STJ118665 100 µl
EUR 277


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NLRP1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLRP1. Recognizes NLRP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NLRP1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLRP1. Recognizes NLRP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NLRP1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLRP1. Recognizes NLRP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Glutathione Monoclonal, 50UG

A001-50UG 50UG
EUR 263

Recombinant Obelin, 50UG

L001-50UG 50UG
EUR 258

NLRP1 Rabbit pAb

A16212-100ul 100 ul
EUR 308

NLRP1 Rabbit pAb

A16212-200ul 200 ul
EUR 459

NLRP1 Rabbit pAb

A16212-20ul 20 ul
EUR 183

NLRP1 Rabbit pAb

A16212-50ul 50 ul
EUR 223

NLRP1 Blocking Peptide

33R-2204 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NLRP1 antibody, catalog no. 70R-2731

NLRP1 Blocking Peptide

DF13187-BP 1mg
EUR 195

NLRP1 cloning plasmid

CSB-CL871630HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 441
  • Sequence: atgcccctggacccctaccactctgtgacgtgggggcacgcgcagggatcccatcattttgtgtttggggagctcagagtgcgcccaatcttggaatctttaagggatgagccagacccagacccgcggccttctagagagggtccggcagggagggtcggcgccctggcccgggg
  • Show more
Description: A cloning plasmid for the NLRP1 gene.


PVT13289 2 ug
EUR 391

PGE2 Monoclonal Antibody (clone 5A2), 50UG

A011-50UG 50UG
EUR 587

NLRP1 Polyclonal Antibody, HRP Conjugated

A67467 100 µg
EUR 570.55
Description: The best epigenetics products

NLRP1 Polyclonal Antibody, FITC Conjugated

A67468 100 µg
EUR 570.55
Description: kits suitable for this type of research

NLRP1 Polyclonal Antibody, Biotin Conjugated

A67469 100 µg
EUR 570.55
Description: fast delivery possible

L-Cysteine Monoclonal, 50UG

A002-50UG 50UG
EUR 263


ELI-22325h 96 Tests
EUR 824

Human NLRP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NLRP1 Recombinant Protein (Human)

RP021322 100 ug Ask for price

ThioStar? Fluorescent Thiol Substrate, 50UG

L002-50UG 50UG
EUR 207

Polyclonal NALP1 / NLRP1 Antibody (C-Terminus)

APR02275G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NALP1 / NLRP1 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal NLRP1 antibody - N-terminal region

APR01245G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NLRP1 - N-terminal region. This antibody is tested and proven to work in the following applications:

NLRP1 antibody, 50ug