February 26, 2021

NLN Medium, w/ Vitamins 1x50L

NLN Medium, w/ Vitamins 1x50L 

To Order Contact us: bjorn@lembcke.dk


D04-116-10kg 10 kg
EUR 4539


D04-116-2Kg 2 Kg
EUR 1026


D04-116-500g 500 g
EUR 315

BME 100X Vitamins for Basal Medium Eagle (Modified)

BML01-100ML 100 ml
EUR 73
  • Product line: Animal Cell Culture Media
  • Product family: Basal Medium Eagle
Description: 100X Vitamins for Basal Medium Eagle (Modified)

BME 100X Vitamins for Basal Medium Eagle (Modified)

BML01-500ML 500 ml
EUR 92
  • Product line: Animal Cell Culture Media
  • Product family: Basal Medium Eagle
Description: 100X Vitamins for Basal Medium Eagle (Modified)

Gamborg's B-5 Medium; With Vitamins and Sucrose

CP012-010 10X1L
EUR 104

Gamborg's B-5 Medium; With Vitamins and Sucrose

CP012-500 50L
EUR 126

Schneider's Medium, w/ L-glutamine

CCM1318-500 500 mL
EUR 86.94
  • Product category: Culture Media

Nln/ Rat Nln ELISA Kit

ELI-13139r 96 Tests
EUR 886

Medium 199, with L-Glutamine, w/ Earle's salts 

CCM2441-500 500 mL
EUR 68.07
  • Product category: Culture Media


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NLN antibody

10R-7058 100 ul
EUR 691
Description: Mouse monoclonal NLN antibody

NLN antibody

10R-4996 100 ul
EUR 691
Description: Mouse monoclonal NLN antibody

NLN antibody

10R-4997 100 ul
EUR 691
Description: Mouse monoclonal NLN antibody

NLN antibody

10R-4998 100 ul
EUR 691
Description: Mouse monoclonal NLN antibody

NLN antibody

10R-4999 100 ul
EUR 691
Description: Mouse monoclonal NLN antibody

NLN antibody

10R-5000 100 ul
EUR 691
Description: Mouse monoclonal NLN antibody

NLN antibody

70R-18895 50 ul
EUR 435
Description: Rabbit polyclonal NLN antibody

NLN Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLN. Recognizes NLN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200

NLN Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NLN. Recognizes NLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


PVT18527 2 ug
EUR 231

Murashige and Skoog, With Vitamins

CP030-010 10X1L
EUR 99

Murashige and Skoog, With Vitamins

CP030-500 50L
EUR 126

anti- NLN antibody

FNab05756 100µg
EUR 505.25
  • Immunogen: neurolysin(metallopeptidase M3 family)
  • Uniprot ID: Q9BYT8
  • Gene ID: 57486
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against NLN

Neurolysin (NLN) Antibody

abx146313-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Neurolysin (NLN) Antibody

abx031296-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neurolysin (NLN) Antibody

abx031296-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neurolysin (NLN) Antibody

abx235756-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

NLN Rabbit pAb

A13112-100ul 100 ul
EUR 308

NLN Rabbit pAb

A13112-200ul 200 ul
EUR 459

NLN Rabbit pAb

A13112-20ul 20 ul
EUR 183

NLN Rabbit pAb

A13112-50ul 50 ul
EUR 223

NLN Polyclonal Antibody

27904-100ul 100ul
EUR 252

NLN Polyclonal Antibody

27904-50ul 50ul
EUR 187

NLN cloning plasmid

CSB-CL863161HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1824
  • Sequence: atgatcgcccggtgccttttggctgtgcgaagcctccgcagagttggtggttccaggattttactcagaatgacgttaggaagagaagtgatgtctcctcttcaggcaatgtcttcctatactgtggctggcagaaatgttttaagatgggatctttcaccagagcaaattaaaa
  • Show more
Description: A cloning plasmid for the NLN gene.

Anti-NLN antibody

PAab05756 100 ug
EUR 355

Anti-NLN antibody

STJ115078 100 µl
EUR 277
Description: This gene encodes a member of the metallopeptidase M3 protein family that cleaves neurotensin at the Pro10-Tyr11 bond, leading to the formation of neurotensin(1-10) and neurotensin(11-13). The encoded protein is likely involved in the termination of the neurotensinergic signal in the central nervous system and in the gastrointestinal tract.


25-020-CI 100 mL/pk
EUR 67
Description: Media Catalog; Cell Culture Reagents

Murashige and Skoog, With Gamborg's Vitamins

CP029-010 10X1L
EUR 113

Murashige and Skoog, With Gamborg's Vitamins

CP029-500 50L
EUR 138

Polyclonal NLN Antibody (Center)

APR08745G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NLN (Center). This antibody is tested and proven to work in the following applications:

NLN Polyclonal Conjugated Antibody

C27904 100ul
EUR 397

Mouse NLN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NLN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF001255 96 Tests
EUR 689

Human NLN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NLN Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NLN. Recognizes NLN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NLN Medium, w/ Vitamins 1x50L