NAMPT Lentiviral Vector (Human)

NAMPT Lentiviral Vector (Human) 

To Order Contact us: bjorn@lembcke.dk

NAMPT siRNA
20-abx925375	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NAMPT Antibody
ABD6059	Lifescience Market	100 ug	EUR 438

NAMPT Antibody
32047-100ul	SAB	100ul	EUR 252

NAMPT antibody
70R-18744	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NAMPT antibody

NAMPT Antibody
DF6059	Affbiotech	200ul	EUR 304
Description: NAMPT Antibody detects endogenous levels of total NAMPT.

NAMPT Antibody
1-CSB-PA215740	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

NAMPT Antibody
1-CSB-PA200625	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

NAMPT Antibody
1-CSB-PA015422EA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

NAMPT Antibody
1-CSB-PA015422ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

NAMPT Antibody
1-CSB-PA015422ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

NAMPT Antibody
1-CSB-PA015422GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

NAMPT Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV690919	ABM	1.0 ug DNA	EUR 682

NAMPT Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV690923	ABM	1.0 ug DNA	EUR 682

NAMPT Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV690924	ABM	1.0 ug DNA	EUR 682

Human Visfatin (NAMPT) Protein
abx670218-25ug	Abbexa	25 ug	EUR 551
Shipped within 1 week.

Human NAMPT ELISA Kit
ELA-E0638h	Lifescience Market	96 Tests	EUR 824

NAMPT ELISA KIT|Human
EF000420	Lifescience Market	96 Tests	EUR 689

Human NAMPT shRNA Plasmid
20-abx956836	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NAMPT Recombinant Protein (Human)
RP020647	ABM	100 ug	Ask for price

Human NAMPT ELISA Kit
STJ150458	St John's Laboratory	1 kit	EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of VF in human serum, plasma and other biological fluids

Nampt ORF Vector (Rat) (pORF)
ORF071078	ABM	1.0 ug DNA	EUR 506

Nampt ORF Vector (Mouse) (pORF)
ORF051013	ABM	1.0 ug DNA	EUR 506

NAMPT Protein Vector (Human) (pPB-C-His)
PV027529	ABM	500 ng	EUR 329

NAMPT Protein Vector (Human) (pPB-N-His)
PV027530	ABM	500 ng	EUR 329

NAMPT Protein Vector (Human) (pPM-C-HA)
PV027531	ABM	500 ng	EUR 329

NAMPT Protein Vector (Human) (pPM-C-His)
PV027532	ABM	500 ng	EUR 329

Nampt-IN-1
B1171-25	Biovision		EUR 675

Nampt-IN-1
B1171-5	Biovision		EUR 207

NAMPT Conjugated Antibody
C32047	SAB	100ul	EUR 397

NAMPT cloning plasmid
CSB-CL015422HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1476 Sequence: atgaatcctgcggcagaagccgagttcaacatcctcctggccaccgactcctacaaggttactcactataaacaatatccacccaacacaagcaaagtttattcctactttgaatgccgtgaaaagaagacagaaaactccaaattaaggaaggtgaaatatgaggaaacagtat Show more
Description: A cloning plasmid for the NAMPT gene.

Nampt-IN-1
HY-12971	MedChemExpress	100mg	EUR 2943

Anti-NAMPT Antibody
A1301-50	Biovision		EUR 387

NAMPT Blocking Peptide
DF6059-BP	Affbiotech	1mg	EUR 195

Anti-NAMPT Antibody
STJ503509	St John's Laboratory	100 µg	EUR 476

Anti-NAMPT Antibody
STJ503510	St John's Laboratory	100 µg	EUR 476

P7C3 (NAMPT activator)
SIH-571-25MG	Stressmarq	25 mg	EUR 395
Description: The substance P7C3 is a nampt activator. It is synthetically produced and has a purity of >98%. The pure substance is off-white powder which is May be dissolved in DMSO (40 mg/ml).

P7C3 (NAMPT activator)
SIH-571-5MG	Stressmarq	5 mg	EUR 171
Description: The substance P7C3 is a nampt activator. It is synthetically produced and has a purity of >98%. The pure substance is off-white powder which is May be dissolved in DMSO (40 mg/ml).

Anti-NAMPT antibody
STJ24679	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, one step in the biosynthesis of nicotinamide adenine dinucleotide. The protein belongs to the nicotinic acid phosphoribosyltransferase (NAPRTase) family and is thought to be involved in many important biological processes, including metabolism, stress response and aging. This gene has a pseudogene on chromosome 10.

NAMPT ELISA Kit (Human) (OKCD06613)
OKCD06613	Aviva Systems Biology	96 Wells	EUR 753
Description: Description of target: PBEF1 catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, one step in the biosynthesis of nicotinamide adenine dinucleotide. The protein is an adipokine that is localized to the bloodstream and has various functions, including the promotion of vascular smooth muscle cell maturation and inhibition of neutrophil apoptosis. It also activates insulin receptor and has insulin-mimetic effects, lowering blood glucose and improving insulin sensitivity. The protein is highly expressed in visceral fat and serum levels of the protein correlate with obesity.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

Polyclonal NAMPT Antibody (Center)
APR07016G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NAMPT (Center). This antibody is tested and proven to work in the following applications:

Mouse NAMPT shRNA Plasmid
20-abx975153	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat NAMPT shRNA Plasmid
20-abx988864	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Visfatin / PBEF (NAMPT) Antibody
20-abx114108	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody
abx122493-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody
20-abx000641	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody
20-abx137233	Abbexa	EUR 704.00 EUR 328.00 EUR 230.00	100 ug 20 ug 5 ug
Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody
abx037068-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody
abx034196-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody
abx034196-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody
20-abx320240	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody
20-abx322338	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody
20-abx213969	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody
abx414754-01mg	Abbexa	0.1 mg	EUR 537
Shipped within 1 week.

Visfatin / PBEF (NAMPT) Antibody
abx239412-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Visfatin / PBEF (NAMPT) Antibody
20-abx242153	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody
20-abx302448	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody
20-abx225304	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

PBEF / NAMPT Rabbit pAb
A0256-100ul	Abclonal	100 ul	EUR 308

PBEF / NAMPT Rabbit pAb
A0256-200ul	Abclonal	200 ul	EUR 459

PBEF / NAMPT Rabbit pAb
A0256-20ul	Abclonal	20 ul	EUR 183

PBEF / NAMPT Rabbit pAb
A0256-50ul	Abclonal	50 ul	EUR 223

NAMPT Antibody, HRP conjugated
1-CSB-PA015422EB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NAMPT Antibody, FITC conjugated
1-CSB-PA015422EC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NAMPT Antibody, Biotin conjugated
1-CSB-PA015422ED01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Visfatin/NAMPT Antibody
PB10009	BosterBio	100ug/vial	EUR 334

NAMPT Recombinant Protein (Rat)
RP213230	ABM	100 ug	Ask for price

NAMPT Recombinant Protein (Mouse)
RP153035	ABM	100 ug	Ask for price

Anti-NAMPT Antibody (Biotin)
STJ503511	St John's Laboratory	100 µg	EUR 586

Anti-NAMPT Antibody (FITC)
STJ503512	St John's Laboratory	100 µg	EUR 586

Anti-NAMPT Antibody (Biotin)
STJ503513	St John's Laboratory	100 µg	EUR 586

Anti-NAMPT Antibody (FITC)
STJ503514	St John's Laboratory	100 µg	EUR 586

Human Visfatin / PBEF (NAMPT) ELISA Kit
20-abx585030	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit
E01N0539-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit
E01N0539-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit
E01N0539-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human NAMPT/ Nicotinamide phosphoribosyltransferase ELISA Kit
E2812Hu	Sunlong	1 Kit	EUR 563

Human NAMPT(Nicotinamide phosphoribosyltransferase) ELISA Kit
EH0651	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: P43490 Alias: VF(Visfatin)/NAMPT/NAmPRTase/NMPRTase/PBEF1/Visfatin/NAmPRTase/Nampt/nicotinamide phosphoribosyltransferase/Pre-B cell-enhancing factor/pre-B-cell colony enhancing factor 1/Pre-B-cell colony-e Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Nicotinamide phosphoribosyltransferase, NAMPT ELISA KIT
ELI-02262h	Lifescience Market	96 Tests	EUR 824

Human Visfatin / PBEF (NAMPT) ELISA Kit
20-abx153483	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Visfatin / PBEF (NAMPT) ELISA Kit
20-abx257282	Abbexa	EUR 355.00 EUR 707.00	24 tests 96 tests
Shipped within 5-12 working days.

Human Visfatin / PBEF (NAMPT) ELISA Kit
20-abx253615	Abbexa	EUR 355.00 EUR 707.00	24 tests 96 tests
Shipped within 5-12 working days.

NAMPT sgRNA CRISPR Lentivector set (Human)
K1387801	ABM	3 x 1.0 ug	EUR 339

Human Nampt (Visfatin/PBEF) ELISA Kit
LF-EK70006	Abfrontier	1×96T	EUR 715

Human NAMPT/Visfatin ELISA Kit(VF)
RK00320	Abclonal	96 Tests	EUR 521

NAMPT Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV690920	ABM	1.0 ug DNA	EUR 682

NAMPT Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV690921	ABM	1.0 ug DNA	EUR 740

NAMPT Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV690922	ABM	1.0 ug DNA	EUR 740

NAMPT Protein Vector (Rat) (pPB-C-His)
PV284310	ABM	500 ng	EUR 603

NAMPT Protein Vector (Rat) (pPB-N-His)
PV284311	ABM	500 ng	EUR 603

NAMPT Protein Vector (Rat) (pPM-C-HA)
PV284312	ABM	500 ng	EUR 603

NAMPT Protein Vector (Rat) (pPM-C-His)
PV284313	ABM	500 ng	EUR 603

NAMPT Protein Vector (Mouse) (pPB-C-His)
PV204050	ABM	500 ng	EUR 603

NAMPT Protein Vector (Mouse) (pPB-N-His)
PV204051	ABM	500 ng	EUR 603

NAMPT Protein Vector (Mouse) (pPM-C-HA)
PV204052	ABM	500 ng	EUR 603

NAMPT Protein Vector (Mouse) (pPM-C-His)
PV204053	ABM	500 ng	EUR 603

NAMPT sgRNA CRISPR Lentivector (Human) (Target 1)
K1387802	ABM	1.0 ug DNA	EUR 154

NAMPT sgRNA CRISPR Lentivector (Human) (Target 2)
K1387803	ABM	1.0 ug DNA	EUR 154

NAMPT sgRNA CRISPR Lentivector (Human) (Target 3)
K1387804	ABM	1.0 ug DNA	EUR 154

Nampt (Visfatin/PBEF) (human) Intracellular ELISA Kit
K4909-100	Biovision		EUR 985

Human Intracellular Nampt (Visfatin/PBEF) ELISA Kit
LF-EK70008	Abfrontier	1×96T	EUR 699

NAMPT ELISA Kit (Human) : 96 Wells (OKEH02844)
OKEH02844	Aviva Systems Biology	96 Wells	EUR 596
Description: Description of target: This gene encodes a protein that catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, one step in the biosynthesis of nicotinamide adenine dinucleotide. The protein belongs to the nicotinic acid phosphoribosyltransferase (NAPRTase) family and is thought to be involved in many important biological processes, including metabolism, stress response and aging. This gene has a pseudogene on chromosome 10.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.78 ng/mL

Visfatin / PBEF (NAMPT) Antibody (HRP)
20-abx317040	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody (FITC)
20-abx317041	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody (Biotin)
20-abx317042	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

NAMPT ELISA Kit (Mouse) (OKAN06508)
OKAN06508	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12.9 pg/mL

NAMPT ELISA Kit (Rat) (OKAN06636)
OKAN06636	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: has similarity to cytokines but is not secreted; localized to the nucleus and cytoplasm, changes in subcellular localization may be associated with the cell cycle [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

NAMPT ELISA Kit (Mouse) (OKCD03082)
OKCD03082	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Recombinant Mouse Visfatin;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 12.9pg/mL

NAMPT ELISA Kit (Rat) (OKCD06614)
OKCD06614	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: has similarity to cytokines but is not secreted; localized to the nucleus and cytoplasm, changes in subcellular localization may be associated with the cell cycle.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

NAMPT ELISA Kit (Mouse) (OKEH04361)
OKEH04361	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: The secreted form behaves both as a cytokine with immunomodulating properties and an adipokine with anti-diabetic properties, it has no enzymatic activity, partly because of lack of activation by ATP, which has a low level in extracellular space and plasma (By similarity). Catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, an intermediate in the biosynthesis of NAD. It is the rate limiting component in the mammalian NAD biosynthesis pathway. Plays a role in the modulation of circadian clock function. NAMPT-dependent oscillatory production of NAD regulates oscillation of clock target gene expression by releasing the core clock component: CLOCK-ARNTL/BMAL1 heterodimer from NAD-dependent SIRT1-mediated suppression.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.158 ng/mL

NAMPT ELISA Kit (Rat) (OKEH04362)
OKEH04362	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: has similarity to cytokines but is not secreted; localized to the nucleus and cytoplasm, changes in subcellular localization may be associated with the cell cycle [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.7 pg/mL

NAMPT ELISA Kit (Pig) (OKEH07442)
OKEH07442	Aviva Systems Biology	96 Wells	EUR 1184
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.2ng/mL

Polyclonal NAMPT / Visfatin Antibody (aa30-80)
APR08590G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NAMPT / Visfatin (aa30-80). This antibody is tested and proven to work in the following applications:

Pig Visfatin / PBEF (NAMPT) ELISA Kit
abx360941-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Visfatin / PBEF (NAMPT) ELISA Kit
abx362838-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Visfatin / PBEF (NAMPT) ELISA Kit
abx513586-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat Visfatin / PBEF (NAMPT) ELISA Kit
20-abx585029	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Visfatin / PBEF (NAMPT) ELISA Kit
20-abx585031	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Nampt/ Nicotinamide phosphoribosyltransferase ELISA Kit
E0659Ra	Sunlong	1 Kit	EUR 571

Rat Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit
E02N0539-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit
E02N0539-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

NAMPT Lentiviral Vector (Human)