October 24, 2021

NAMPT Lentiviral Vector (Human)

NAMPT Lentiviral Vector (Human) 

To Order Contact us: bjorn@lembcke.dk

NAMPT Antibody

DF6059 200ul
EUR 304
Description: NAMPT Antibody detects endogenous levels of total NAMPT.

NAMPT Antibody

1-CSB-PA015422EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

NAMPT Antibody

1-CSB-PA015422ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

NAMPT Antibody

1-CSB-PA015422ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

NAMPT Antibody

1-CSB-PA015422GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

NAMPT Antibody

1-CSB-PA200625
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

NAMPT Antibody

1-CSB-PA215740
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

NAMPT siRNA

20-abx903462
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NAMPT siRNA

20-abx925374
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NAMPT siRNA

20-abx925375
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NAMPT Antibody

ABD6059 100 ug
EUR 438

NAMPT Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV690919 1.0 ug DNA
EUR 682

NAMPT Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV690923 1.0 ug DNA
EUR 682

NAMPT Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV690924 1.0 ug DNA
EUR 682

Human NAMPT ELISA Kit

ELA-E0638h 96 Tests
EUR 824

NAMPT ELISA KIT|Human

EF000420 96 Tests
EUR 689

Human Visfatin (NAMPT) Protein

abx670218-25ug 25 ug
EUR 551
  • Shipped within 1 week.

Human NAMPT shRNA Plasmid

20-abx956836
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NAMPT Recombinant Protein (Human)

RP020647 100 ug Ask for price

Human NAMPT ELISA Kit

STJ150458 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of VF in human serum, plasma and other biological fluids

Nampt ORF Vector (Rat) (pORF)

ORF071078 1.0 ug DNA
EUR 506

Nampt ORF Vector (Mouse) (pORF)

ORF051013 1.0 ug DNA
EUR 506

NAMPT Protein Vector (Human) (pPB-C-His)

PV027529 500 ng
EUR 329

NAMPT Protein Vector (Human) (pPB-N-His)

PV027530 500 ng
EUR 329

NAMPT Protein Vector (Human) (pPM-C-HA)

PV027531 500 ng
EUR 329

NAMPT Protein Vector (Human) (pPM-C-His)

PV027532 500 ng
EUR 329

Anti-NAMPT Antibody

A1301-50
EUR 387

Nampt-IN-1

B1171-25
EUR 675

Nampt-IN-1

B1171-5
EUR 207

NAMPT Blocking Peptide

DF6059-BP 1mg
EUR 195

NAMPT Conjugated Antibody

C32047 100ul
EUR 397

NAMPT cloning plasmid

CSB-CL015422HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1476
  • Sequence: atgaatcctgcggcagaagccgagttcaacatcctcctggccaccgactcctacaaggttactcactataaacaatatccacccaacacaagcaaagtttattcctactttgaatgccgtgaaaagaagacagaaaactccaaattaaggaaggtgaaatatgaggaaacagtat
  • Show more
Description: A cloning plasmid for the NAMPT gene.

Nampt-IN-1

HY-12971 100mg
EUR 2943

P7C3 (NAMPT activator)

SIH-571-25MG 25 mg
EUR 395
Description: The substance P7C3 is a nampt activator. It is synthetically produced and has a purity of >98%. The pure substance is off-white powder which is May be dissolved in DMSO (40 mg/ml).

P7C3 (NAMPT activator)

SIH-571-5MG 5 mg
EUR 171
Description: The substance P7C3 is a nampt activator. It is synthetically produced and has a purity of >98%. The pure substance is off-white powder which is May be dissolved in DMSO (40 mg/ml).

Anti-NAMPT antibody

STJ24679 100 µl
EUR 277
Description: This gene encodes a protein that catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, one step in the biosynthesis of nicotinamide adenine dinucleotide. The protein belongs to the nicotinic acid phosphoribosyltransferase (NAPRTase) family and is thought to be involved in many important biological processes, including metabolism, stress response and aging. This gene has a pseudogene on chromosome 10.

Anti-NAMPT Antibody

STJ503509 100 µg
EUR 476

Anti-NAMPT Antibody

STJ503510 100 µg
EUR 476

NAMPT ELISA Kit (Human) (OKCD06613)

OKCD06613 96 Wells
EUR 753
Description: Description of target: PBEF1 catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, one step in the biosynthesis of nicotinamide adenine dinucleotide. The protein is an adipokine that is localized to the bloodstream and has various functions, including the promotion of vascular smooth muscle cell maturation and inhibition of neutrophil apoptosis. It also activates insulin receptor and has insulin-mimetic effects, lowering blood glucose and improving insulin sensitivity. The protein is highly expressed in visceral fat and serum levels of the protein correlate with obesity.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

NAMPT Antibody, HRP conjugated

1-CSB-PA015422EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NAMPT Antibody, FITC conjugated

1-CSB-PA015422EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NAMPT Antibody, Biotin conjugated

1-CSB-PA015422ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PBEF / NAMPT Rabbit pAb

A0256-100ul 100 ul
EUR 308

PBEF / NAMPT Rabbit pAb

A0256-200ul 200 ul
EUR 459

PBEF / NAMPT Rabbit pAb

A0256-20ul 20 ul
EUR 183

PBEF / NAMPT Rabbit pAb

A0256-50ul 50 ul
EUR 223

Visfatin / PBEF (NAMPT) Antibody

20-abx213969
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

20-abx114108
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

abx037068-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

20-abx137233
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

abx122493-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

abx034196-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

abx034196-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

abx239412-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Visfatin / PBEF (NAMPT) Antibody

20-abx242153
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Rat NAMPT shRNA Plasmid

20-abx988864
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NAMPT shRNA Plasmid

20-abx975153
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal NAMPT Antibody (Center)

APR07016G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NAMPT (Center). This antibody is tested and proven to work in the following applications:

Visfatin / PBEF (NAMPT) Antibody

20-abx320240
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

abx414754-01mg 0.1 mg
EUR 537
  • Shipped within 1 week.

Visfatin / PBEF (NAMPT) Antibody

20-abx322338
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

20-abx302448
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

20-abx225304
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

20-abx000641
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-Visfatin/NAMPT Antibody

PB10009 100ug/vial
EUR 334

NAMPT Recombinant Protein (Mouse)

RP153035 100 ug Ask for price

NAMPT Recombinant Protein (Rat)

RP213230 100 ug Ask for price

Anti-NAMPT Antibody (Biotin)

STJ503511 100 µg
EUR 586

Anti-NAMPT Antibody (FITC)

STJ503512 100 µg
EUR 586

Anti-NAMPT Antibody (Biotin)

STJ503513 100 µg
EUR 586

Anti-NAMPT Antibody (FITC)

STJ503514 100 µg
EUR 586

Human Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E01N0539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E01N0539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E01N0539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Visfatin / PBEF (NAMPT) ELISA Kit

20-abx153483
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Visfatin / PBEF (NAMPT) ELISA Kit

20-abx257282
  • EUR 355.00
  • EUR 707.00
  • 24 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Visfatin / PBEF (NAMPT) ELISA Kit

20-abx253615
  • EUR 355.00
  • EUR 707.00
  • 24 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human NAMPT/ Nicotinamide phosphoribosyltransferase ELISA Kit

E2812Hu 1 Kit
EUR 563

Human NAMPT(Nicotinamide phosphoribosyltransferase) ELISA Kit

EH0651 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P43490
  • Alias: VF(Visfatin)/NAMPT/NAmPRTase/NMPRTase/PBEF1/Visfatin/NAmPRTase/Nampt/nicotinamide phosphoribosyltransferase/Pre-B cell-enhancing factor/pre-B-cell colony enhancing factor 1/Pre-B-cell colony-e
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Nicotinamide phosphoribosyltransferase, NAMPT ELISA KIT

ELI-02262h 96 Tests
EUR 824

Human Visfatin / PBEF (NAMPT) ELISA Kit

20-abx585030
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

NAMPT sgRNA CRISPR Lentivector set (Human)

K1387801 3 x 1.0 ug
EUR 339

Human Nampt (Visfatin/PBEF) ELISA Kit

LF-EK70006 1×96T
EUR 715

Human NAMPT/Visfatin ELISA Kit(VF)

RK00320 96 Tests
EUR 521

NAMPT Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV690920 1.0 ug DNA
EUR 682

NAMPT Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV690921 1.0 ug DNA
EUR 740

NAMPT Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV690922 1.0 ug DNA
EUR 740

NAMPT Protein Vector (Mouse) (pPB-C-His)

PV204050 500 ng
EUR 603

NAMPT Protein Vector (Mouse) (pPB-N-His)

PV204051 500 ng
EUR 603

NAMPT Protein Vector (Mouse) (pPM-C-HA)

PV204052 500 ng
EUR 603

NAMPT Protein Vector (Mouse) (pPM-C-His)

PV204053 500 ng
EUR 603

NAMPT Protein Vector (Rat) (pPB-C-His)

PV284310 500 ng
EUR 603

NAMPT Protein Vector (Rat) (pPB-N-His)

PV284311 500 ng
EUR 603

NAMPT Protein Vector (Rat) (pPM-C-HA)

PV284312 500 ng
EUR 603

NAMPT Protein Vector (Rat) (pPM-C-His)

PV284313 500 ng
EUR 603

Nampt (Visfatin/PBEF) (human) Intracellular ELISA Kit

K4909-100
EUR 985

NAMPT Lentiviral Vector (Human)