January 26, 2021

NAMPT Lentiviral Vector (Human)

NAMPT Lentiviral Vector (Human) 

To Order Contact us: bjorn@lembcke.dk


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NAMPT Antibody

ABD6059 100 ug
EUR 438

NAMPT Antibody

32047-100ul 100ul
EUR 252

NAMPT antibody

70R-18744 50 ul
EUR 435
Description: Rabbit polyclonal NAMPT antibody

NAMPT Antibody

DF6059 200ul
EUR 304
Description: NAMPT Antibody detects endogenous levels of total NAMPT.

NAMPT Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

NAMPT Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

NAMPT Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

NAMPT Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

NAMPT Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

NAMPT Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

NAMPT Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV690919 1.0 ug DNA
EUR 682

NAMPT Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV690923 1.0 ug DNA
EUR 682

NAMPT Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV690924 1.0 ug DNA
EUR 682

Human Visfatin (NAMPT) Protein

abx670218-25ug 25 ug
EUR 551
  • Shipped within 1 week.


ELA-E0638h 96 Tests
EUR 824


EF000420 96 Tests
EUR 689

Human NAMPT shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NAMPT Recombinant Protein (Human)

RP020647 100 ug Ask for price


STJ150458 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of VF in human serum, plasma and other biological fluids

Nampt ORF Vector (Rat) (pORF)

ORF071078 1.0 ug DNA
EUR 506

Nampt ORF Vector (Mouse) (pORF)

ORF051013 1.0 ug DNA
EUR 506

NAMPT Protein Vector (Human) (pPB-C-His)

PV027529 500 ng
EUR 329

NAMPT Protein Vector (Human) (pPB-N-His)

PV027530 500 ng
EUR 329

NAMPT Protein Vector (Human) (pPM-C-HA)

PV027531 500 ng
EUR 329

NAMPT Protein Vector (Human) (pPM-C-His)

PV027532 500 ng
EUR 329


EUR 675


EUR 207

NAMPT Conjugated Antibody

C32047 100ul
EUR 397

NAMPT cloning plasmid

CSB-CL015422HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1476
  • Sequence: atgaatcctgcggcagaagccgagttcaacatcctcctggccaccgactcctacaaggttactcactataaacaatatccacccaacacaagcaaagtttattcctactttgaatgccgtgaaaagaagacagaaaactccaaattaaggaaggtgaaatatgaggaaacagtat
  • Show more
Description: A cloning plasmid for the NAMPT gene.


HY-12971 100mg
EUR 2943

Anti-NAMPT Antibody

EUR 387

NAMPT Blocking Peptide

DF6059-BP 1mg
EUR 195

Anti-NAMPT Antibody

STJ503509 100 µg
EUR 476

Anti-NAMPT Antibody

STJ503510 100 µg
EUR 476

P7C3 (NAMPT activator)

SIH-571-25MG 25 mg
EUR 395
Description: The substance P7C3 is a nampt activator. It is synthetically produced and has a purity of >98%. The pure substance is off-white powder which is May be dissolved in DMSO (40 mg/ml).

P7C3 (NAMPT activator)

SIH-571-5MG 5 mg
EUR 171
Description: The substance P7C3 is a nampt activator. It is synthetically produced and has a purity of >98%. The pure substance is off-white powder which is May be dissolved in DMSO (40 mg/ml).

Anti-NAMPT antibody

STJ24679 100 µl
EUR 277
Description: This gene encodes a protein that catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, one step in the biosynthesis of nicotinamide adenine dinucleotide. The protein belongs to the nicotinic acid phosphoribosyltransferase (NAPRTase) family and is thought to be involved in many important biological processes, including metabolism, stress response and aging. This gene has a pseudogene on chromosome 10.

NAMPT ELISA Kit (Human) (OKCD06613)

OKCD06613 96 Wells
EUR 753
Description: Description of target: PBEF1 catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, one step in the biosynthesis of nicotinamide adenine dinucleotide. The protein is an adipokine that is localized to the bloodstream and has various functions, including the promotion of vascular smooth muscle cell maturation and inhibition of neutrophil apoptosis. It also activates insulin receptor and has insulin-mimetic effects, lowering blood glucose and improving insulin sensitivity. The protein is highly expressed in visceral fat and serum levels of the protein correlate with obesity.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

Polyclonal NAMPT Antibody (Center)

APR07016G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NAMPT (Center). This antibody is tested and proven to work in the following applications:

Mouse NAMPT shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NAMPT shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Visfatin / PBEF (NAMPT) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

abx122493-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

abx037068-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

abx034196-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

abx034196-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

abx414754-01mg 0.1 mg
EUR 537
  • Shipped within 1 week.

Visfatin / PBEF (NAMPT) Antibody

abx239412-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Visfatin / PBEF (NAMPT) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

PBEF / NAMPT Rabbit pAb

A0256-100ul 100 ul
EUR 308

PBEF / NAMPT Rabbit pAb

A0256-200ul 200 ul
EUR 459

PBEF / NAMPT Rabbit pAb

A0256-20ul 20 ul
EUR 183

PBEF / NAMPT Rabbit pAb

A0256-50ul 50 ul
EUR 223

NAMPT Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NAMPT Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NAMPT Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NAMPT. Recognizes NAMPT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Visfatin/NAMPT Antibody

PB10009 100ug/vial
EUR 334

NAMPT Recombinant Protein (Rat)

RP213230 100 ug Ask for price

NAMPT Recombinant Protein (Mouse)

RP153035 100 ug Ask for price

Anti-NAMPT Antibody (Biotin)

STJ503511 100 µg
EUR 586

Anti-NAMPT Antibody (FITC)

STJ503512 100 µg
EUR 586

Anti-NAMPT Antibody (Biotin)

STJ503513 100 µg
EUR 586

Anti-NAMPT Antibody (FITC)

STJ503514 100 µg
EUR 586

Human Visfatin / PBEF (NAMPT) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E01N0539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E01N0539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E01N0539-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human NAMPT/ Nicotinamide phosphoribosyltransferase ELISA Kit

E2812Hu 1 Kit
EUR 563

Human NAMPT(Nicotinamide phosphoribosyltransferase) ELISA Kit

EH0651 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P43490
  • Alias: VF(Visfatin)/NAMPT/NAmPRTase/NMPRTase/PBEF1/Visfatin/NAmPRTase/Nampt/nicotinamide phosphoribosyltransferase/Pre-B cell-enhancing factor/pre-B-cell colony enhancing factor 1/Pre-B-cell colony-e
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Nicotinamide phosphoribosyltransferase, NAMPT ELISA KIT

ELI-02262h 96 Tests
EUR 824

Human Visfatin / PBEF (NAMPT) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Visfatin / PBEF (NAMPT) ELISA Kit

  • EUR 355.00
  • EUR 707.00
  • 24 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Visfatin / PBEF (NAMPT) ELISA Kit

  • EUR 355.00
  • EUR 707.00
  • 24 tests
  • 96 tests
  • Shipped within 5-12 working days.

NAMPT sgRNA CRISPR Lentivector set (Human)

K1387801 3 x 1.0 ug
EUR 339

Human Nampt (Visfatin/PBEF) ELISA Kit

LF-EK70006 1×96T
EUR 715

Human NAMPT/Visfatin ELISA Kit(VF)

RK00320 96 Tests
EUR 521

NAMPT Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV690920 1.0 ug DNA
EUR 682

NAMPT Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV690921 1.0 ug DNA
EUR 740

NAMPT Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV690922 1.0 ug DNA
EUR 740

NAMPT Protein Vector (Rat) (pPB-C-His)

PV284310 500 ng
EUR 603

NAMPT Protein Vector (Rat) (pPB-N-His)

PV284311 500 ng
EUR 603

NAMPT Protein Vector (Rat) (pPM-C-HA)

PV284312 500 ng
EUR 603

NAMPT Protein Vector (Rat) (pPM-C-His)

PV284313 500 ng
EUR 603

NAMPT Protein Vector (Mouse) (pPB-C-His)

PV204050 500 ng
EUR 603

NAMPT Protein Vector (Mouse) (pPB-N-His)

PV204051 500 ng
EUR 603

NAMPT Protein Vector (Mouse) (pPM-C-HA)

PV204052 500 ng
EUR 603

NAMPT Protein Vector (Mouse) (pPM-C-His)

PV204053 500 ng
EUR 603

NAMPT sgRNA CRISPR Lentivector (Human) (Target 1)

K1387802 1.0 ug DNA
EUR 154

NAMPT sgRNA CRISPR Lentivector (Human) (Target 2)

K1387803 1.0 ug DNA
EUR 154

NAMPT sgRNA CRISPR Lentivector (Human) (Target 3)

K1387804 1.0 ug DNA
EUR 154

Nampt (Visfatin/PBEF) (human) Intracellular ELISA Kit

EUR 985

Human Intracellular Nampt (Visfatin/PBEF) ELISA Kit

LF-EK70008 1×96T
EUR 699

NAMPT ELISA Kit (Human) : 96 Wells (OKEH02844)

OKEH02844 96 Wells
EUR 596
Description: Description of target: This gene encodes a protein that catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, one step in the biosynthesis of nicotinamide adenine dinucleotide. The protein belongs to the nicotinic acid phosphoribosyltransferase (NAPRTase) family and is thought to be involved in many important biological processes, including metabolism, stress response and aging. This gene has a pseudogene on chromosome 10.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.78 ng/mL

Visfatin / PBEF (NAMPT) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Visfatin / PBEF (NAMPT) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NAMPT ELISA Kit (Mouse) (OKAN06508)

OKAN06508 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12.9 pg/mL

NAMPT ELISA Kit (Rat) (OKAN06636)

OKAN06636 96 Wells
EUR 792
Description: Description of target: has similarity to cytokines but is not secreted; localized to the nucleus and cytoplasm, changes in subcellular localization may be associated with the cell cycle [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

NAMPT ELISA Kit (Mouse) (OKCD03082)

OKCD03082 96 Wells
EUR 779
Description: Description of target: Recombinant Mouse Visfatin;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 12.9pg/mL

NAMPT ELISA Kit (Rat) (OKCD06614)

OKCD06614 96 Wells
EUR 818
Description: Description of target: has similarity to cytokines but is not secreted; localized to the nucleus and cytoplasm, changes in subcellular localization may be associated with the cell cycle.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

NAMPT ELISA Kit (Mouse) (OKEH04361)

OKEH04361 96 Wells
EUR 662
Description: Description of target: The secreted form behaves both as a cytokine with immunomodulating properties and an adipokine with anti-diabetic properties, it has no enzymatic activity, partly because of lack of activation by ATP, which has a low level in extracellular space and plasma (By similarity). Catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, an intermediate in the biosynthesis of NAD. It is the rate limiting component in the mammalian NAD biosynthesis pathway. Plays a role in the modulation of circadian clock function. NAMPT-dependent oscillatory production of NAD regulates oscillation of clock target gene expression by releasing the core clock component: CLOCK-ARNTL/BMAL1 heterodimer from NAD-dependent SIRT1-mediated suppression.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.158 ng/mL

NAMPT ELISA Kit (Rat) (OKEH04362)

OKEH04362 96 Wells
EUR 662
Description: Description of target: has similarity to cytokines but is not secreted; localized to the nucleus and cytoplasm, changes in subcellular localization may be associated with the cell cycle [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.7 pg/mL

NAMPT ELISA Kit (Pig) (OKEH07442)

OKEH07442 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.2ng/mL

Polyclonal NAMPT / Visfatin Antibody (aa30-80)

APR08590G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NAMPT / Visfatin (aa30-80). This antibody is tested and proven to work in the following applications:

Pig Visfatin / PBEF (NAMPT) ELISA Kit

abx360941-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Visfatin / PBEF (NAMPT) ELISA Kit

abx362838-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Visfatin / PBEF (NAMPT) ELISA Kit

abx513586-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Visfatin / PBEF (NAMPT) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Visfatin / PBEF (NAMPT) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Nampt/ Nicotinamide phosphoribosyltransferase ELISA Kit

E0659Ra 1 Kit
EUR 571

Rat Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E02N0539-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Nicotinamide phosphoribosyltransferase(NAMPT) ELISA kit

E02N0539-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Nicotinamide phosphoribosyltransferase(NAMPT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

NAMPT Lentiviral Vector (Human)