LYVE1 Lentiviral Vector Human CMV

LYVE1 Lentiviral Vector Human CMV 

To Order Contact us: bjorn@lembcke.dk

LYVE1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV654044	ABM	1.0 ug DNA	EUR 682

LYVE1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV654045	ABM	1.0 ug DNA	EUR 740

LYVE1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV654046	ABM	1.0 ug DNA	EUR 740

CMV Control lentiviral particles (GFP-Bsd)
CMV-Null-GB	GenTarget	1 x107 IFU/ml x 200ul	EUR 349
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the GFP-Blasticidin fusion marker under RSV promoter.

CMV Control lentiviral particles (GFP-Puro)
CMV-Null-GP	GenTarget	1 x107 IFU/ml x 200ul	EUR 349
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the GFP-Puromycin fusion marker under RSV promoter.

CMV Control lentiviral particles (RFP-Bsd)
CMV-Null-RB	GenTarget	1 x107 IFU/ml x 200ul	EUR 349
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the RFP-Blasticidin fusion marker under RSV promoter.

CMV Control lentiviral particles (RFP-Puro)
CMV-Null-RP	GenTarget	1 x107 IFU/ml x 200ul	EUR 349
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the RFP-Puromycin fusion marker under RSV promoter.

LYVE1 ORF Vector (Human) (pORF)
ORF006169	ABM	1.0 ug DNA	EUR 95

LYVE1 Antibody
AF4202	Affbiotech	200ul	EUR 376
Description: The antibody detects endogenous level of total Lymphatic vessel endothelial hyaluronic acid receptor 1 protein.

LYVE1 Antibody
ABF4202	Lifescience Market	100 ug	EUR 438

LYVE1 siRNA
20-abx923216	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LYVE1 siRNA
20-abx923217	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LYVE1 antibody
70R-LR003	Fitzgerald	50 ug	EUR 507
Description: Affinity purified Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-LR004	Fitzgerald	100 ug	EUR 422
Description: Affinity purified Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-LR005	Fitzgerald	100 ug	EUR 422
Description: Affinity purified Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-LR006	Fitzgerald	200 ug	EUR 497
Description: Affinity purified Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-6181	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal LYVE1 antibody raised against the N terminal of LYVE1

LYVE1 Antibody
35806-100ul	SAB	100ul	EUR 252

LYVE1 Antibody
49343-100ul	SAB	100ul	EUR 333

LYVE1 Antibody
49343-50ul	SAB	50ul	EUR 239

LYVE1 antibody
10R-1025	Fitzgerald	100 ul	EUR 316
Description: Mouse monoclonal LYVE1 antibody

LYVE1 antibody
10R-6400	Fitzgerald	100 ug	EUR 343
Description: Rat monoclonal LYVE1 antibody

LYVE1 protein
30R-AL010	Fitzgerald	20 ug	EUR 242
Description: Purified recombinant Human LYVE1 protein

LYVE1 antibody
20R-2482	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-18338	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-11548	Fitzgerald	100 ug	EUR 527
Description: Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-11549	Fitzgerald	100 ug	EUR 527
Description: Rabbit polyclonal LYVE1 antibody

LYVE1 Antibody
1-CSB-PA897574EA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

LYVE1 Antibody
1-CSB-PA897574ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

LYVE1 Antibody
1-CSB-PA897574ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LYVE1 Antibody
1-CSB-PA915341	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

LYVE1 Antibody
1-CSB-PA013282GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

LYVE1 Antibody
1-CSB-PA561582	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:100-1:500, IHC:1:25-1:100

LYVE1 Antibody
CSB-PA566878-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

LYVE1 Antibody
CSB-PA566878-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

anti-LYVE1
YF-PA17283	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to LYVE1

CMV Control lentiviral particles (Bsd) in PBS
CMV-Null-Bsd-PBS	GenTarget	1 x108 IFU/ml x 200ul	EUR 710
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the blasticidin marker under RSV promoter. The virus was concentrated and provided in PBS solution.

CMV Control lentiviral particles (Neo) in PBS
CMV-Null-Neo-PBS	GenTarget	1 x108 IFU/ml x 200ul	EUR 710
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the Neomycin marker under RSV promoter. The virus was concentrated and provided in PBS solution.

CMV Control lentiviral particles (Puro) in PBS
CMV-Null-Puro-PBS	GenTarget	1 x108 IFU/ml x 200ul	EUR 710
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the Puromycin marker under RSV promoter. The virus was concentrated and provided in PBS solution.

LYVE1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV654047	ABM	1.0 ug DNA	EUR 682

LYVE1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV654048	ABM	1.0 ug DNA	EUR 682

LYVE1 ELISA KIT|Human
EF005219	Lifescience Market	96 Tests	EUR 689

Human LYVE1 ELISA KIT
ELI-48081h	Lifescience Market	96 Tests	EUR 824

Human LYVE1 shRNA Plasmid
20-abx957424	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

LYVE1 Recombinant Protein (Human)
RP018505	ABM	100 ug	Ask for price

CMV Control lentiviral particles (GFP-Bsd) in PBS
CMV-Null-GB-PBS	GenTarget	1 x108 IFU/ml x 200ul	EUR 710
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the GFP-Blasticidin fusion marker under RSV promoter. The virus was concentrated and provided in PBS solution.

CMV Control lentiviral particles (GFP-Puro) in PBS
CMV-Null-GP-PBS	GenTarget	1 x108 IFU/ml x 200ul	EUR 710
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the GFP-Puromycin fusion marker under RSV promoter. The virus was concentrated and provided in PBS solution.

CMV Control lentiviral particles (RFP-Bsd) in PBS
CMV-Null-RB-PBS	GenTarget	1 x108 IFU/ml x 200ul	EUR 710
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the RFP-Blasticidin fusion marker under RSV promoter. The virus was concentrated and provided in PBS solution.

CMV Control lentiviral particles (RFP-Puro) in PBS
CMV-Null-RP-PBS	GenTarget	1 x108 IFU/ml x 200ul	EUR 710
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the RFP-Puromycin fusion marker under RSV promoter. The virus was concentrated and provided in PBS solution.

Lyve1 ORF Vector (Mouse) (pORF)
ORF049609	ABM	1.0 ug DNA	EUR 506

Lyve1 ORF Vector (Rat) (pORF)
ORF070152	ABM	1.0 ug DNA	EUR 506

CMV control lentivirus (Hygro)
CMV-Null-Hygro	GenTarget	1 x107 IFU/ml x 200ul	EUR 349
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It has the hygromycin selection under RSV promoter.

CMV control lentivirus (Zeo)
CMV-Null-Zeo	GenTarget	1 x107 IFU/ml x 200ul	EUR 349
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It has the Zeocin selection under RSV promoter.

LYVE1 Protein Vector (Human) (pPB-C-His)
PV024673	ABM	500 ng	EUR 329

LYVE1 Protein Vector (Human) (pPB-N-His)
PV024674	ABM	500 ng	EUR 329

LYVE1 Protein Vector (Human) (pPM-C-HA)
PV024675	ABM	500 ng	EUR 329

LYVE1 Protein Vector (Human) (pPM-C-His)
PV024676	ABM	500 ng	EUR 329

LYVE1 Blocking Peptide
AF4202-BP	Affbiotech	1mg	EUR 195

LYVE1 Conjugated Antibody
C35806	SAB	100ul	EUR 397

LYVE1 Polyclonal Antibody
ES11131-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against LYVE1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LYVE1 Polyclonal Antibody
ES11131-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against LYVE1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- LYVE1 antibody
FNab04911	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500 - 1:2000 Immunogen: LYVE1 Uniprot ID: Q9Y5Y7 Gene ID: 10894 Research Area: Cardiovascular
Description: Antibody raised against LYVE1

LYVE1 Polyclonal Antibody
ABP59171-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human LYVE1 protein Applications tips:
Description: A polyclonal antibody for detection of LYVE1 from Human, Mouse. This LYVE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LYVE1 protein

LYVE1 Polyclonal Antibody
ABP59171-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human LYVE1 protein Applications tips:
Description: A polyclonal antibody for detection of LYVE1 from Human, Mouse. This LYVE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LYVE1 protein

LYVE1 Polyclonal Antibody
ABP59171-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human LYVE1 protein Applications tips:
Description: A polyclonal antibody for detection of LYVE1 from Human, Mouse. This LYVE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LYVE1 protein

LYVE1 Rabbit mAb
A4352-100ul	Abclonal	100 ul	EUR 410

LYVE1 Rabbit mAb
A4352-200ul	Abclonal	200 ul	EUR 571

LYVE1 Rabbit mAb
A4352-20ul	Abclonal	20 ul	EUR 221

LYVE1 Rabbit mAb
A4352-50ul	Abclonal	50 ul	EUR 287

LYVE1 Rabbit pAb
A6452-100ul	Abclonal	100 ul	EUR 308

LYVE1 Rabbit pAb
A6452-200ul	Abclonal	200 ul	EUR 459

LYVE1 Rabbit pAb
A6452-20ul	Abclonal	20 ul	EUR 183

LYVE1 Rabbit pAb
A6452-50ul	Abclonal	50 ul	EUR 223

LYVE1 Blocking Peptide
33R-1461	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LYVE1 antibody, catalog no. 70R-6181

LYVE1 protein (Mouse)
30R-AL009	Fitzgerald	20 ug	EUR 242
Description: Purified recombinant Mouse LYVE1 protein

LYVE1 antibody (biotin)
61R-1501	Fitzgerald	100 ug	EUR 457
Description: Rat monoclonal LYVE1 antibody (biotin)

LYVE1 cloning plasmid
CSB-CL897574HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 969 Sequence: atggccaggtgcttcagcctggtgttgcttctcacttccatctggaccacgaggctcctggtccaaggctctttgcgtgcagaagagctttccatccaggtgtcatgcagaattatggggatcacccttgtgagcaaaaaggcgaaccagcagctgaatttcacagaagctaagga Show more
Description: A cloning plasmid for the LYVE1 gene.

Anti-LYVE1 antibody
PAab04911	Lifescience Market	100 ug	EUR 412

Anti-LYVE1 antibody
STJ73129	St John's Laboratory	100 µg	EUR 359

Anti-LYVE1 antibody
STJ28535	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a type I integral membrane glycoprotein. The encoded protein acts as a receptor and binds to both soluble and immobilized hyaluronan. This protein may function in lymphatic hyaluronan transport and have a role in tumor metastasis.

Anti-LYVE1 antibody
STJ192289	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to LYVE1

LYVE1 ELISA Kit (Human) (OKEH07052)
OKEH07052	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Ligand-specific transporter trafficking between intracellular organelles (TGN) and the plasma membrane. Plays a role in autocrine regulation of cell growth mediated by growth regulators containing cell surface retention sequence binding (CRS). May act as a hyaluronan (HA) transporter, either mediating its uptake for catabolism within lymphatic endothelial cells themselves, or its transport into the lumen of afferent lymphatic vessels for subsequent re-uptake and degradation in lymph nodes.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.9 pg/mL

Mouse LYVE1 shRNA Plasmid
20-abx980157	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Bovine LYVE1 ELISA KIT
ELI-16394b	Lifescience Market	96 Tests	EUR 928

Mouse Lyve1 ELISA KIT
ELI-31437m	Lifescience Market	96 Tests	EUR 865

LYVE1 protein (His tag)
80R-1071	Fitzgerald	50 ug	EUR 586
Description: Purified recombinant Human LYVE1 protein

LYVE1 recombinant monoclonal antibody
A5450	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human LYVE1 for WB,ELISA

LYVE1 Antibody, HRP conjugated
1-CSB-PA897574EB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LYVE1 Antibody, FITC conjugated
1-CSB-PA897574EC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LYVE1 Antibody, Biotin conjugated
1-CSB-PA897574ED01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LYVE1 Recombinant Protein (Rat)
RP210452	ABM	100 ug	Ask for price

LYVE1 Recombinant Protein (Mouse)
RP148823	ABM	100 ug	Ask for price

LYVE1 sgRNA CRISPR Lentivector set (Human)
K1249101	ABM	3 x 1.0 ug	EUR 339

LYVE1 Protein Vector (Rat) (pPB-C-His)
PV280606	ABM	500 ng	EUR 603

LYVE1 Protein Vector (Rat) (pPB-N-His)
PV280607	ABM	500 ng	EUR 603

LYVE1 Protein Vector (Rat) (pPM-C-HA)
PV280608	ABM	500 ng	EUR 603

LYVE1 Protein Vector (Rat) (pPM-C-His)
PV280609	ABM	500 ng	EUR 603

LYVE1 Protein Vector (Mouse) (pPB-C-His)
PV198434	ABM	500 ng	EUR 603

LYVE1 Protein Vector (Mouse) (pPB-N-His)
PV198435	ABM	500 ng	EUR 603

LYVE1 Protein Vector (Mouse) (pPM-C-HA)
PV198436	ABM	500 ng	EUR 603

LYVE1 Protein Vector (Mouse) (pPM-C-His)
PV198437	ABM	500 ng	EUR 603

LYVE1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1249102	ABM	1.0 ug DNA	EUR 154

LYVE1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1249103	ABM	1.0 ug DNA	EUR 154

LYVE1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1249104	ABM	1.0 ug DNA	EUR 154

Recombinant Human LYVE1 Protein, Untagged, Insect-100ug
QP12609-0.1mg	EnQuireBio	100ug	EUR 1161

Recombinant Human LYVE1 Protein, Untagged, Insect-10ug
QP12609-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human LYVE1 Protein, Untagged, Insect-2ug
QP12609-2ug	EnQuireBio	2ug	EUR 155

Recombinant Human LYVE1 Protein, GST, E.coli-10ug
QP12609-GST-10ug	EnQuireBio	10ug	EUR 553

Recombinant Human LYVE1 Protein, GST, E.coli-2ug
QP12609-GST-2ug	EnQuireBio	2ug	EUR 245

Recombinant Human LYVE1 Protein, GST, E.coli-5ug
QP12609-GST-5ug	EnQuireBio	5ug	EUR 336

Recombinant Human LYVE1 Protein, His, E.coli-1mg
QP12609-HIS-1mg	EnQuireBio	1mg	EUR 5251

Anti-LYVE1 Rabbit Monoclonal Antibody
M04027	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal LYVE1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

LYVE1 ELISA Kit (Mouse) (OKCD09112)
OKCD09112	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: Recombinant Mouse Lymphatic Vessel Endothelial Hyaluronic Acid Receptor 1, Sf9;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.1pg/mL

LYVE1 ELISA Kit (Mouse) (OKEH03641)
OKEH03641	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Ligand-specific transporter trafficking between intracellular organelles (TGN) and the plasma membrane. Plays a role in autocrine regulation of cell growth mediated by growth regulators containing cell surface retention sequence binding (CRS). May act as a hyaluronan (HA) transporter, either mediating its uptake for catabolism within lymphatic endothelial cells themselves, or its transport into the lumen of afferent lymphatic vessels for subsequent re-uptake and degradation in lymph nodes.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40 pg/mL

Polyclonal LYVE1 (XLKD1) Antibody (C-term)
APR04522G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LYVE1 (XLKD1) (C-term). This antibody is tested and proven to work in the following applications:

Lyve1 sgRNA CRISPR Lentivector set (Mouse)
K4410801	ABM	3 x 1.0 ug	EUR 339

Lyve1 sgRNA CRISPR Lentivector set (Rat)
K6588901	ABM	3 x 1.0 ug	EUR 339

RNU6V Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV746825	ABM	1.0 ug DNA	Ask for price

RNY1P1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV746849	ABM	1.0 ug DNA	Ask for price

RNY1P2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV746855	ABM	1.0 ug DNA	Ask for price

RNY1P3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV746861	ABM	1.0 ug DNA	Ask for price

RNY1P4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV746867	ABM	1.0 ug DNA	Ask for price

RNY1P5 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV746873	ABM	1.0 ug DNA	Ask for price

RNY1P6 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV746879	ABM	1.0 ug DNA	Ask for price

RNY1P7 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV746885	ABM	1.0 ug DNA	Ask for price

RNY1P8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV746891	ABM	1.0 ug DNA	Ask for price

RNY3P1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV746897	ABM	1.0 ug DNA	Ask for price

RNY3P2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV746903	ABM	1.0 ug DNA	Ask for price

LYVE1 Lentiviral Vector Human CMV