October 24, 2021

LYVE1 Lentiviral Vector Human CMV

LYVE1 Lentiviral Vector Human CMV 

To Order Contact us: bjorn@lembcke.dk

LYVE1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV654044 1.0 ug DNA
EUR 682

LYVE1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV654045 1.0 ug DNA
EUR 740

LYVE1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV654046 1.0 ug DNA
EUR 740

CMV Control lentiviral particles (GFP-Bsd)
CMV-Null-GB 1 x107 IFU/ml x 200ul
EUR 349
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the GFP-Blasticidin fusion marker under RSV promoter.

CMV Control lentiviral particles (GFP-Puro)
CMV-Null-GP 1 x107 IFU/ml x 200ul
EUR 349
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the GFP-Puromycin fusion marker under RSV promoter.

CMV Control lentiviral particles (RFP-Bsd)
CMV-Null-RB 1 x107 IFU/ml x 200ul
EUR 349
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the RFP-Blasticidin fusion marker under RSV promoter.

CMV Control lentiviral particles (RFP-Puro)
CMV-Null-RP 1 x107 IFU/ml x 200ul
EUR 349
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the RFP-Puromycin fusion marker under RSV promoter.

LYVE1 ORF Vector (Human) (pORF)
ORF006169 1.0 ug DNA
EUR 95

LYVE1 antibody
20R-2482 50 ug
EUR 281
Description: Rabbit polyclonal LYVE1 antibody

LYVE1 protein
30R-AL010 20 ug
EUR 242
Description: Purified recombinant Human LYVE1 protein

LYVE1 antibody
70R-18338 50 ul
EUR 435
Description: Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-11548 100 ug
EUR 527
Description: Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-11549 100 ug
EUR 527
Description: Rabbit polyclonal LYVE1 antibody

LYVE1 Antibody
35806-100ul 100ul
EUR 252

LYVE1 antibody
10R-1025 100 ul
EUR 316
Description: Mouse monoclonal LYVE1 antibody

LYVE1 antibody
10R-6400 100 ug
EUR 343
Description: Rat monoclonal LYVE1 antibody

LYVE1 Antibody
49343-100ul 100ul
EUR 333

LYVE1 Antibody
49343-50ul 50ul
EUR 239

LYVE1 Antibody
1-CSB-PA915341
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

LYVE1 Antibody
1-CSB-PA897574EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

LYVE1 Antibody
1-CSB-PA897574ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

LYVE1 Antibody
1-CSB-PA897574ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LYVE1 Antibody
1-CSB-PA561582
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:100-1:500, IHC:1:25-1:100

LYVE1 Antibody
CSB-PA566878-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

LYVE1 Antibody
CSB-PA566878-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

LYVE1 antibody
70R-LR003 50 ug
EUR 507
Description: Affinity purified Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-LR004 100 ug
EUR 422
Description: Affinity purified Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-LR005 100 ug
EUR 422
Description: Affinity purified Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-LR006 200 ug
EUR 497
Description: Affinity purified Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-6181 50 ug
EUR 467
Description: Rabbit polyclonal LYVE1 antibody raised against the N terminal of LYVE1

LYVE1 Antibody
AF4202 200ul
EUR 376
Description: The antibody detects endogenous level of total Lymphatic vessel endothelial hyaluronic acid receptor 1 protein.

LYVE1 Antibody
1-CSB-PA013282GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

LYVE1 siRNA
20-abx923216
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LYVE1 siRNA
20-abx923217
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LYVE1 Antibody
ABF4202 100 ug
EUR 438

anti-LYVE1
YF-PA17283 50 ul
EUR 363
Description: Mouse polyclonal to LYVE1

CMV Control lentiviral particles (Bsd) in PBS
CMV-Null-Bsd-PBS 1 x108 IFU/ml x 200ul
EUR 710
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the blasticidin marker under RSV promoter. The virus was concentrated and provided in PBS solution.

CMV Control lentiviral particles (Neo) in PBS
CMV-Null-Neo-PBS 1 x108 IFU/ml x 200ul
EUR 710
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the Neomycin marker under RSV promoter. The virus was concentrated and provided in PBS solution.

CMV Control lentiviral particles (Puro) in PBS
CMV-Null-Puro-PBS 1 x108 IFU/ml x 200ul
EUR 710
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the Puromycin marker under RSV promoter. The virus was concentrated and provided in PBS solution.

LYVE1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV654047 1.0 ug DNA
EUR 682

LYVE1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV654048 1.0 ug DNA
EUR 682

LYVE1 ELISA KIT|Human
EF005219 96 Tests
EUR 689

Human LYVE1 shRNA Plasmid
20-abx957424
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LYVE1 ELISA KIT
ELI-48081h 96 Tests
EUR 824

LYVE1 Recombinant Protein (Human)
RP018505 100 ug Ask for price

CMV Control lentiviral particles (GFP-Bsd) in PBS
CMV-Null-GB-PBS 1 x108 IFU/ml x 200ul
EUR 710
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the GFP-Blasticidin fusion marker under RSV promoter. The virus was concentrated and provided in PBS solution.

CMV Control lentiviral particles (GFP-Puro) in PBS
CMV-Null-GP-PBS 1 x108 IFU/ml x 200ul
EUR 710
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the GFP-Puromycin fusion marker under RSV promoter. The virus was concentrated and provided in PBS solution.

CMV Control lentiviral particles (RFP-Bsd) in PBS
CMV-Null-RB-PBS 1 x108 IFU/ml x 200ul
EUR 710
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the RFP-Blasticidin fusion marker under RSV promoter. The virus was concentrated and provided in PBS solution.

CMV Control lentiviral particles (RFP-Puro) in PBS
CMV-Null-RP-PBS 1 x108 IFU/ml x 200ul
EUR 710
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It also has the RFP-Puromycin fusion marker under RSV promoter. The virus was concentrated and provided in PBS solution.

Lyve1 ORF Vector (Rat) (pORF)
ORF070152 1.0 ug DNA
EUR 506

Lyve1 ORF Vector (Mouse) (pORF)
ORF049609 1.0 ug DNA
EUR 506

CMV control lentivirus (Hygro)
CMV-Null-Hygro 1 x107 IFU/ml x 200ul
EUR 349
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It has the hygromycin selection under RSV promoter.

CMV control lentivirus (Zeo)
CMV-Null-Zeo 1 x107 IFU/ml x 200ul
EUR 349
Description: Negative control lentivirus contains a null spacer insert under CMV promoter, serves as the negative control of lentivurs treatment for the specificity of any target expression effects. It has the Zeocin selection under RSV promoter.

LYVE1 Protein Vector (Human) (pPB-C-His)
PV024673 500 ng
EUR 329

LYVE1 Protein Vector (Human) (pPB-N-His)
PV024674 500 ng
EUR 329

LYVE1 Protein Vector (Human) (pPM-C-HA)
PV024675 500 ng
EUR 329

LYVE1 Protein Vector (Human) (pPM-C-His)
PV024676 500 ng
EUR 329

LYVE1 protein (Mouse)
30R-AL009 20 ug
EUR 242
Description: Purified recombinant Mouse LYVE1 protein

LYVE1 Blocking Peptide
33R-1461 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LYVE1 antibody, catalog no. 70R-6181

LYVE1 antibody (biotin)
61R-1501 100 ug
EUR 457
Description: Rat monoclonal LYVE1 antibody (biotin)

LYVE1 cloning plasmid
CSB-CL897574HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 969
  • Sequence: atggccaggtgcttcagcctggtgttgcttctcacttccatctggaccacgaggctcctggtccaaggctctttgcgtgcagaagagctttccatccaggtgtcatgcagaattatggggatcacccttgtgagcaaaaaggcgaaccagcagctgaatttcacagaagctaagga
  • Show more
Description: A cloning plasmid for the LYVE1 gene.

LYVE1 Blocking Peptide
AF4202-BP 1mg
EUR 195

LYVE1 Conjugated Antibody
C35806 100ul
EUR 397

LYVE1 Rabbit mAb
A4352-100ul 100 ul
EUR 410

LYVE1 Rabbit mAb
A4352-200ul 200 ul
EUR 571

LYVE1 Rabbit mAb
A4352-20ul 20 ul
EUR 221

LYVE1 Rabbit mAb
A4352-50ul 50 ul
EUR 287

LYVE1 Rabbit pAb
A6452-100ul 100 ul
EUR 308

LYVE1 Rabbit pAb
A6452-200ul 200 ul
EUR 459

LYVE1 Rabbit pAb
A6452-20ul 20 ul
EUR 183

LYVE1 Rabbit pAb
A6452-50ul 50 ul
EUR 223

LYVE1 Polyclonal Antibody
ABP59171-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human LYVE1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LYVE1 from Human, Mouse. This LYVE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LYVE1 protein

LYVE1 Polyclonal Antibody
ABP59171-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LYVE1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LYVE1 from Human, Mouse. This LYVE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LYVE1 protein

LYVE1 Polyclonal Antibody
ABP59171-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LYVE1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LYVE1 from Human, Mouse. This LYVE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LYVE1 protein

anti- LYVE1 antibody
FNab04911 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • Immunogen: LYVE1
  • Uniprot ID: Q9Y5Y7
  • Gene ID: 10894
  • Research Area: Cardiovascular
Description: Antibody raised against LYVE1

LYVE1 Polyclonal Antibody
ES11131-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LYVE1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LYVE1 Polyclonal Antibody
ES11131-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LYVE1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-LYVE1 antibody
PAab04911 100 ug
EUR 412

Anti-LYVE1 antibody
STJ28535 100 µl
EUR 277
Description: This gene encodes a type I integral membrane glycoprotein. The encoded protein acts as a receptor and binds to both soluble and immobilized hyaluronan. This protein may function in lymphatic hyaluronan transport and have a role in tumor metastasis.

Anti-LYVE1 antibody
STJ73129 100 µg
EUR 359

Anti-LYVE1 antibody
STJ192289 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LYVE1

LYVE1 ELISA Kit (Human) (OKEH07052)
OKEH07052 96 Wells
EUR 662
Description: Description of target: Ligand-specific transporter trafficking between intracellular organelles (TGN) and the plasma membrane. Plays a role in autocrine regulation of cell growth mediated by growth regulators containing cell surface retention sequence binding (CRS). May act as a hyaluronan (HA) transporter, either mediating its uptake for catabolism within lymphatic endothelial cells themselves, or its transport into the lumen of afferent lymphatic vessels for subsequent re-uptake and degradation in lymph nodes.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.9 pg/mL

LYVE1 Antibody, HRP conjugated
1-CSB-PA897574EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LYVE1 Antibody, FITC conjugated
1-CSB-PA897574EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LYVE1 Antibody, Biotin conjugated
1-CSB-PA897574ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LYVE1 protein (His tag)
80R-1071 50 ug
EUR 586
Description: Purified recombinant Human LYVE1 protein

Bovine LYVE1 ELISA KIT
ELI-16394b 96 Tests
EUR 928

Mouse Lyve1 ELISA KIT
ELI-31437m 96 Tests
EUR 865

Mouse LYVE1 shRNA Plasmid
20-abx980157
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LYVE1 recombinant monoclonal antibody
A5450 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human LYVE1 for WB,ELISA

LYVE1 Recombinant Protein (Mouse)
RP148823 100 ug Ask for price

LYVE1 Recombinant Protein (Rat)
RP210452 100 ug Ask for price

LYVE1 sgRNA CRISPR Lentivector set (Human)
K1249101 3 x 1.0 ug
EUR 339

LYVE1 Protein Vector (Rat) (pPB-C-His)
PV280606 500 ng
EUR 603

LYVE1 Protein Vector (Rat) (pPB-N-His)
PV280607 500 ng
EUR 603

LYVE1 Protein Vector (Rat) (pPM-C-HA)
PV280608 500 ng
EUR 603

LYVE1 Lentiviral Vector Human CMV