May 10, 2021

IRF3 sgRNA RISPR Lentivirus (Human)

IRF3 sgRNA RISPR Lentivirus (Human) 

To Order Contact us:

Human Interferon Regulatory Factor 3 (IRF3) ELISA Kit

RD-IRF3-Hu-96Tests 96 Tests
EUR 606

Mouse Interferon Regulatory Factor 3 (IRF3) ELISA Kit

DLR-IRF3-Mu-48T 48T
EUR 454
  • Should the Mouse Interferon Regulatory Factor 3 (IRF3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Interferon Regulatory Factor 3 (IRF3) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Interferon Regulatory Factor 3 (IRF3) ELISA Kit

DLR-IRF3-Mu-96T 96T
EUR 587
  • Should the Mouse Interferon Regulatory Factor 3 (IRF3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Interferon Regulatory Factor 3 (IRF3) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Interferon Regulatory Factor 3 (IRF3) ELISA Kit

RDR-IRF3-Mu-48Tests 48 Tests
EUR 470

Mouse Interferon Regulatory Factor 3 (IRF3) ELISA Kit

RDR-IRF3-Mu-96Tests 96 Tests
EUR 651

Mouse Interferon Regulatory Factor 3 (IRF3) ELISA Kit

RD-IRF3-Mu-48Tests 48 Tests
EUR 450

Mouse Interferon Regulatory Factor 3 (IRF3) ELISA Kit

RD-IRF3-Mu-96Tests 96 Tests
EUR 622

Human IRF3 Antibody

32892-05111 150 ug
EUR 261

IRF3, human recombinant

EUR 349

IRF3 sgRNA CRISPR Lentivector set (Human)

K1098501 3 x 1.0 ug
EUR 339

IRF3 protein

30R-1090 100 ug
EUR 305
Description: Purified recombinant Human IRF3 protein

IRF3 Antibody

24264-100ul 100ul
EUR 390

IRF3 Antibody

24265-100ul 100ul
EUR 390

IRF3 antibody

70R-18007 50 ul
EUR 435
Description: Rabbit polyclonal IRF3 antibody

IRF3 antibody

70R-12475 100 ul
EUR 447
Description: Rabbit polyclonal IRF3 antibody

IRF3 Antibody

32639-100ul 100ul
EUR 252

IRF3 Antibody

EUR 349

IRF3 antibody

10R-4473 100 ul
EUR 691
Description: Mouse monoclonal IRF3 antibody

IRF3 antibody

10R-1058 100 ul
EUR 316
Description: Mouse monoclonal IRF3 antibody

IRF3 antibody

10R-1207 100 ug
EUR 512
Description: Mouse monoclonal IRF3 antibody

IRF3 Antibody

49122-100ul 100ul
EUR 333

IRF3 Antibody

49122-50ul 50ul
EUR 239

IRF3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against IRF3. Recognizes IRF3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

IRF3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against IRF3. Recognizes IRF3 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-1:300, ELISA:1:5000-1:20000

IRF3 Antibody

DF6895 200ul
EUR 304
Description: IRF3 Antibody detects endogenous levels of total IRF3.

IRF3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against IRF3. Recognizes IRF3 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-1:300, ELISA:1:5000-1:20000

IRF3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IRF3. Recognizes IRF3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

IRF3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IRF3. Recognizes IRF3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

IRF3 antibody

70R-35868 100 ug
EUR 327
Description: Rabbit polyclonal IRF3 antibody

IRF3 antibody

70R-35894 100 ug
EUR 327
Description: Rabbit polyclonal IRF3 antibody

IRF3 antibody

70R-32755 100 ug
EUR 327
Description: Rabbit polyclonal IRF3 antibody

IRF3 Antibody

AF6438 200ul
EUR 304
Description: IRF3 Antibody detects endogenous levels of total IRF3.

IRF3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against IRF3. Recognizes IRF3 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

IRF3 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against IRF3. Recognizes IRF3 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

IRF3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against IRF3. Recognizes IRF3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

IRF3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IRF3. Recognizes IRF3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Irf3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Irf3. Recognizes Irf3 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IRF3 Antibody

ABF6438 100 ug
EUR 438

IRF3 Antibody

ABD6895 100 ug
EUR 438


YF-PA12769 50 ul
EUR 363
Description: Mouse polyclonal to IRF3


YF-PA12770 50 ug
EUR 363
Description: Mouse polyclonal to IRF3


YF-PA12771 100 ul
EUR 403
Description: Rabbit polyclonal to IRF3


YF-PA12772 100 ug
EUR 403
Description: Rabbit polyclonal to IRF3

Human IRF3 ELISA Kit

ELA-E1491h 96 Tests
EUR 824


EF005816 96 Tests
EUR 689

Human IRF3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IRF3 Recombinant Protein (Human)

RP016312 100 ug Ask for price

Antibody for Human IRF3

SPC-1298D 0.1ml
EUR 314
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is unconjugated.

Antibody for Human IRF3

SPC-1298D-A390 0.1ml
EUR 361
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to ATTO 390.

Antibody for Human IRF3

SPC-1298D-A488 0.1ml
EUR 360
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to ATTO 488.

Antibody for Human IRF3

SPC-1298D-A565 0.1ml
EUR 360
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to ATTO 565.

Antibody for Human IRF3

SPC-1298D-A594 0.1ml
EUR 360
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to ATTO 594.

Antibody for Human IRF3

SPC-1298D-A633 0.1ml
EUR 360
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to ATTO 633.

Antibody for Human IRF3

SPC-1298D-A655 0.1ml
EUR 360
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to ATTO 655.

Antibody for Human IRF3

SPC-1298D-A680 0.1ml
EUR 360
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to ATTO 680.

Antibody for Human IRF3

SPC-1298D-A700 0.1ml
EUR 360
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to ATTO 700.

Antibody for Human IRF3

SPC-1298D-ALP 0.1ml
EUR 355
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human IRF3

SPC-1298D-APC 0.1ml
EUR 359
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to APC .

Antibody for Human IRF3

SPC-1298D-APCCY7 0.1ml
EUR 432
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to APC/Cy7.

Antibody for Human IRF3

SPC-1298D-BI 0.1ml
EUR 357
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to Biotin.

Antibody for Human IRF3

SPC-1298D-DY350 0.1ml
EUR 436
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to Dylight 350.

Antibody for Human IRF3

SPC-1298D-DY405 0.1ml
EUR 412
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to Dylight 405.

Antibody for Human IRF3

SPC-1298D-DY488 0.1ml
EUR 393
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to Dylight 488.

Antibody for Human IRF3

SPC-1298D-DY594 0.1ml
EUR 397
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to Dylight 594.

Antibody for Human IRF3

SPC-1298D-DY633 0.1ml
EUR 387
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to Dylight 633.

Antibody for Human IRF3

SPC-1298D-FITC 0.1ml
EUR 353
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to FITC.

Antibody for Human IRF3

SPC-1298D-HRP 0.1ml
EUR 349
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to HRP.

Antibody for Human IRF3

SPC-1298D-P594 0.1ml
EUR 367
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to PE/ATTO 594.

Antibody for Human IRF3

SPC-1298D-PCP 0.1ml
EUR 359
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to PerCP.

Antibody for Human IRF3

SPC-1298D-RPE 0.1ml
EUR 358
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to RPE .

Antibody for Human IRF3

SPC-1298D-STR 0.1ml
EUR 359
  • Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon
  • Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to Streptavidin.

IRF3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1098502 1.0 ug DNA
EUR 154

IRF3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1098503 1.0 ug DNA
EUR 154

IRF3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1098504 1.0 ug DNA
EUR 154

IRF3 Rabbit pAb

A0816-100ul 100 ul
EUR 308

IRF3 Rabbit pAb

A0816-200ul 200 ul
EUR 459

IRF3 Rabbit pAb

A0816-20ul 20 ul
EUR 183

IRF3 Rabbit pAb

A0816-50ul 50 ul
EUR 223

IRF3 Rabbit pAb

A11373-100ul 100 ul
EUR 308

IRF3 Rabbit pAb

A11373-200ul 200 ul
EUR 459

IRF3 Rabbit pAb

A11373-20ul 20 ul
EUR 183

IRF3 Rabbit pAb

A11373-50ul 50 ul
EUR 223

IRF3 Blocking Peptide

DF6895-BP 1mg
EUR 195

IRF3 antibody (Ser396)

70R-35220 100 ug
EUR 327
Description: Purified Rabbit polyclonal IRF3 antibody (Ser396)

IRF3 antibody (Ser385)

70R-36574 100 ug
EUR 327
Description: Rabbit polyclonal IRF3 antibody (Ser385)

IRF3 antibody (Ser386)

70R-32754 100 ug
EUR 327
Description: Rabbit polyclonal IRF3 antibody (Ser386)

IRF3 (pS386) Antibody

  • EUR 592.00
  • EUR 857.00
  • EUR 411.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

IRF3 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

IRF3 (pS385) Antibody

  • EUR 384.00
  • EUR 606.00
  • EUR 230.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Mouse Irf3 Antibody

abx031370-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Irf3 Antibody

abx031370-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

IRF3 Conjugated Antibody

C49122 100ul
EUR 397

IRF3 Blocking Peptide

AF6438-BP 1mg
EUR 195

IRF3 Conjugated Antibody

C32639 100ul
EUR 397

Polyclonal IRF3 Antibody

APR06360G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IRF3 . This antibody is tested and proven to work in the following applications:

Polyclonal IRF3 Antibody

APR06361G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IRF3 . This antibody is tested and proven to work in the following applications:

Polyclonal IRF3 Antibody

APR08027G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IRF3 . This antibody is tested and proven to work in the following applications:

IRF3 (pS386) Antibody

abx332924-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

IRF3 (pS385) Antibody

abx333023-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

IRF3 cloning plasmid

CSB-CL011818HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1359
  • Sequence: atgggaaccccaaagccacggatcctgccctggctggtgtcgcagctggacctggggcaactggagggcgtggcctgggtgaacaagagccgcacgcgcttccgcatcccttggaagcacggcctacggcaggatgcacagcaggaggatttcggaatcttccaggcctgggccg
  • Show more
Description: A cloning plasmid for the IRF3 gene.

IRF3 Rabbit pAb

A2172-100ul 100 ul
EUR 308

IRF3 Rabbit pAb

A2172-200ul 200 ul
EUR 459

IRF3 Rabbit pAb

A2172-20ul 20 ul
EUR 183

IRF3 Rabbit pAb

A2172-50ul 50 ul
EUR 223

IRF3 Polyclonal Antibody

ABP57604-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic peptide from human protein at AA range: 1268-1341
  • Applications tips:
Description: A polyclonal antibody for detection of IRF3 from Human. This IRF3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1268-1341

IRF3 Polyclonal Antibody

ABP57604-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 1268-1341
  • Applications tips:
Description: A polyclonal antibody for detection of IRF3 from Human. This IRF3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1268-1341

IRF3 Polyclonal Antibody

ABP57604-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 1268-1341
  • Applications tips:
Description: A polyclonal antibody for detection of IRF3 from Human. This IRF3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1268-1341

IRF3 Polyclonal Antibody

ABP57605-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic peptide from human protein at AA range: 1268-1341
  • Applications tips:
Description: A polyclonal antibody for detection of IRF3 from Human. This IRF3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1268-1341

IRF3 Polyclonal Antibody

ABP57605-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic peptide from human protein at AA range: 1268-1341
  • Applications tips:
Description: A polyclonal antibody for detection of IRF3 from Human. This IRF3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1268-1341

IRF3 Polyclonal Antibody

ABP57605-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic peptide from human protein at AA range: 1268-1341
  • Applications tips:
Description: A polyclonal antibody for detection of IRF3 from Human. This IRF3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1268-1341

IRF3 Polyclonal Antibody

ES8597-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IRF3 from Human. This antibody is tested and validated for IHC, WB, ELISA

IRF3 Polyclonal Antibody

ES8597-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IRF3 from Human. This antibody is tested and validated for IHC, WB, ELISA

IRF3 sgRNA RISPR Lentivirus (Human)