IRF3 sgRNA RISPR Lentivirus (Human)

IRF3 sgRNA RISPR Lentivirus (Human) 

To Order Contact us: bjorn@lembcke.dk

Human Interferon Regulatory Factor 3 (IRF3) ELISA Kit
RD-IRF3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 606

Mouse Interferon Regulatory Factor 3 (IRF3) ELISA Kit
DLR-IRF3-Mu-48T	DL Develop	48T	EUR 454
Should the Mouse Interferon Regulatory Factor 3 (IRF3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Interferon Regulatory Factor 3 (IRF3) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Interferon Regulatory Factor 3 (IRF3) ELISA Kit
DLR-IRF3-Mu-96T	DL Develop	96T	EUR 587
Should the Mouse Interferon Regulatory Factor 3 (IRF3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Interferon Regulatory Factor 3 (IRF3) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Interferon Regulatory Factor 3 (IRF3) ELISA Kit
RDR-IRF3-Mu-48Tests	Reddot Biotech	48 Tests	EUR 470

Mouse Interferon Regulatory Factor 3 (IRF3) ELISA Kit
RDR-IRF3-Mu-96Tests	Reddot Biotech	96 Tests	EUR 651

Mouse Interferon Regulatory Factor 3 (IRF3) ELISA Kit
RD-IRF3-Mu-48Tests	Reddot Biotech	48 Tests	EUR 450

Mouse Interferon Regulatory Factor 3 (IRF3) ELISA Kit
RD-IRF3-Mu-96Tests	Reddot Biotech	96 Tests	EUR 622

Human IRF3 Antibody
32892-05111	AssayPro	150 ug	EUR 261

IRF3, human recombinant
7323-50	Biovision		EUR 349

IRF3 sgRNA CRISPR Lentivector set (Human)
K1098501	ABM	3 x 1.0 ug	EUR 339

IRF3 protein
30R-1090	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant Human IRF3 protein

IRF3 Antibody
24264-100ul	SAB	100ul	EUR 390

IRF3 Antibody
24265-100ul	SAB	100ul	EUR 390

IRF3 antibody
70R-18007	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal IRF3 antibody

IRF3 antibody
70R-12475	Fitzgerald	100 ul	EUR 447
Description: Rabbit polyclonal IRF3 antibody

IRF3 Antibody
32639-100ul	SAB	100ul	EUR 252

IRF3 Antibody
3877-100	Biovision		EUR 349

IRF3 antibody
10R-4473	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal IRF3 antibody

IRF3 antibody
10R-1058	Fitzgerald	100 ul	EUR 316
Description: Mouse monoclonal IRF3 antibody

IRF3 antibody
10R-1207	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal IRF3 antibody

IRF3 Antibody
49122-100ul	SAB	100ul	EUR 333

IRF3 Antibody
49122-50ul	SAB	50ul	EUR 239

IRF3 Antibody
1-CSB-PA003063	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against IRF3. Recognizes IRF3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

IRF3 Antibody
1-CSB-PA952191	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against IRF3. Recognizes IRF3 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-1:300, ELISA:1:5000-1:20000

IRF3 Antibody
DF6895	Affbiotech	200ul	EUR 304
Description: IRF3 Antibody detects endogenous levels of total IRF3.

IRF3 Antibody
1-CSB-PA510322	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against IRF3. Recognizes IRF3 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-1:300, ELISA:1:5000-1:20000

IRF3 Antibody
1-CSB-PA572418	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IRF3. Recognizes IRF3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

IRF3 Antibody
1-CSB-PA283183	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IRF3. Recognizes IRF3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

IRF3 antibody
70R-35868	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal IRF3 antibody

IRF3 antibody
70R-35894	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal IRF3 antibody

IRF3 antibody
70R-32755	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal IRF3 antibody

IRF3 Antibody
AF6438	Affbiotech	200ul	EUR 304
Description: IRF3 Antibody detects endogenous levels of total IRF3.

IRF3 Antibody
1-CSB-PA011241	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against IRF3. Recognizes IRF3 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

IRF3 Antibody
1-CSB-PA011242	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against IRF3. Recognizes IRF3 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

IRF3 Antibody
1-CSB-PA011818GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against IRF3. Recognizes IRF3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

IRF3 Antibody
1-CSB-PA011818LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IRF3. Recognizes IRF3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Irf3 Antibody
1-CSB-PA011818YA01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Irf3. Recognizes Irf3 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

IRF3 siRNA
20-abx920798	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IRF3 siRNA
20-abx920799	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IRF3 Antibody
ABF6438	Lifescience Market	100 ug	EUR 438

IRF3 Antibody
ABD6895	Lifescience Market	100 ug	EUR 438

anti-IRF3
YF-PA12769	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to IRF3

anti-IRF3
YF-PA12770	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to IRF3

anti-IRF3
YF-PA12771	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to IRF3

anti-IRF3
YF-PA12772	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to IRF3

Human IRF3 ELISA Kit
ELA-E1491h	Lifescience Market	96 Tests	EUR 824

IRF3 ELISA KIT|Human
EF005816	Lifescience Market	96 Tests	EUR 689

Human IRF3 shRNA Plasmid
20-abx952454	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

IRF3 Recombinant Protein (Human)
RP016312	ABM	100 ug	Ask for price

Antibody for Human IRF3
SPC-1298D	Stressmarq	0.1ml	EUR 314
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is unconjugated.

Antibody for Human IRF3
SPC-1298D-A390	Stressmarq	0.1ml	EUR 361
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to ATTO 390.

Antibody for Human IRF3
SPC-1298D-A488	Stressmarq	0.1ml	EUR 360
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to ATTO 488.

Antibody for Human IRF3
SPC-1298D-A565	Stressmarq	0.1ml	EUR 360
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to ATTO 565.

Antibody for Human IRF3
SPC-1298D-A594	Stressmarq	0.1ml	EUR 360
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to ATTO 594.

Antibody for Human IRF3
SPC-1298D-A633	Stressmarq	0.1ml	EUR 360
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to ATTO 633.

Antibody for Human IRF3
SPC-1298D-A655	Stressmarq	0.1ml	EUR 360
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to ATTO 655.

Antibody for Human IRF3
SPC-1298D-A680	Stressmarq	0.1ml	EUR 360
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to ATTO 680.

Antibody for Human IRF3
SPC-1298D-A700	Stressmarq	0.1ml	EUR 360
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to ATTO 700.

Antibody for Human IRF3
SPC-1298D-ALP	Stressmarq	0.1ml	EUR 355
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human IRF3
SPC-1298D-APC	Stressmarq	0.1ml	EUR 359
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to APC .

Antibody for Human IRF3
SPC-1298D-APCCY7	Stressmarq	0.1ml	EUR 432
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to APC/Cy7.

Antibody for Human IRF3
SPC-1298D-BI	Stressmarq	0.1ml	EUR 357
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to Biotin.

Antibody for Human IRF3
SPC-1298D-DY350	Stressmarq	0.1ml	EUR 436
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to Dylight 350.

Antibody for Human IRF3
SPC-1298D-DY405	Stressmarq	0.1ml	EUR 412
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to Dylight 405.

Antibody for Human IRF3
SPC-1298D-DY488	Stressmarq	0.1ml	EUR 393
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to Dylight 488.

Antibody for Human IRF3
SPC-1298D-DY594	Stressmarq	0.1ml	EUR 397
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to Dylight 594.

Antibody for Human IRF3
SPC-1298D-DY633	Stressmarq	0.1ml	EUR 387
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to Dylight 633.

Antibody for Human IRF3
SPC-1298D-FITC	Stressmarq	0.1ml	EUR 353
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to FITC.

Antibody for Human IRF3
SPC-1298D-HRP	Stressmarq	0.1ml	EUR 349
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to HRP.

Antibody for Human IRF3
SPC-1298D-P594	Stressmarq	0.1ml	EUR 367
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to PE/ATTO 594.

Antibody for Human IRF3
SPC-1298D-PCP	Stressmarq	0.1ml	EUR 359
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to PerCP.

Antibody for Human IRF3
SPC-1298D-RPE	Stressmarq	0.1ml	EUR 358
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to RPE .

Antibody for Human IRF3
SPC-1298D-STR	Stressmarq	0.1ml	EUR 359
Interferon regulatory factors (IRFs) comprise a family of transcription factors that function with the Jak/Stat pathway to regulate interferon (IFN) and IFN-inducible gene expression in response to viral infection. IRF3 is a member of the interferon Show more
Description: A polyclonal antibody for IRF3 from Human. The antibody is produced in rabbit after immunization with Human A synthesized peptide derived from human IRF3. The Antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:2000), IHC (1:200), ICC/IF (1:500). This IRF3 antibody is conjugated to Streptavidin.

IRF3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1098502	ABM	1.0 ug DNA	EUR 154

IRF3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1098503	ABM	1.0 ug DNA	EUR 154

IRF3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1098504	ABM	1.0 ug DNA	EUR 154

IRF3 Rabbit pAb
A0816-100ul	Abclonal	100 ul	EUR 308

IRF3 Rabbit pAb
A0816-200ul	Abclonal	200 ul	EUR 459

IRF3 Rabbit pAb
A0816-20ul	Abclonal	20 ul	EUR 183

IRF3 Rabbit pAb
A0816-50ul	Abclonal	50 ul	EUR 223

IRF3 Rabbit pAb
A11373-100ul	Abclonal	100 ul	EUR 308

IRF3 Rabbit pAb
A11373-200ul	Abclonal	200 ul	EUR 459

IRF3 Rabbit pAb
A11373-20ul	Abclonal	20 ul	EUR 183

IRF3 Rabbit pAb
A11373-50ul	Abclonal	50 ul	EUR 223

IRF3 Blocking Peptide
DF6895-BP	Affbiotech	1mg	EUR 195

IRF3 antibody (Ser396)
70R-35220	Fitzgerald	100 ug	EUR 327
Description: Purified Rabbit polyclonal IRF3 antibody (Ser396)

IRF3 antibody (Ser385)
70R-36574	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal IRF3 antibody (Ser385)

IRF3 antibody (Ser386)
70R-32754	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal IRF3 antibody (Ser386)

IRF3 (pS386) Antibody
20-abx123424	Abbexa	EUR 592.00 EUR 857.00 EUR 411.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

IRF3 Blocking Peptide
20-abx162126	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

IRF3 (pS385) Antibody
20-abx141048	Abbexa	EUR 384.00 EUR 606.00 EUR 230.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Mouse Irf3 Antibody
abx031370-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Mouse Irf3 Antibody
abx031370-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

IRF3 Conjugated Antibody
C49122	SAB	100ul	EUR 397

IRF3 Blocking Peptide
AF6438-BP	Affbiotech	1mg	EUR 195

IRF3 Conjugated Antibody
C32639	SAB	100ul	EUR 397

Polyclonal IRF3 Antibody
APR06360G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IRF3 . This antibody is tested and proven to work in the following applications:

Polyclonal IRF3 Antibody
APR06361G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IRF3 . This antibody is tested and proven to work in the following applications:

Polyclonal IRF3 Antibody
APR08027G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IRF3 . This antibody is tested and proven to work in the following applications:

IRF3 (pS386) Antibody
abx332924-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

IRF3 (pS385) Antibody
abx333023-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

IRF3 cloning plasmid
CSB-CL011818HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1359 Sequence: atgggaaccccaaagccacggatcctgccctggctggtgtcgcagctggacctggggcaactggagggcgtggcctgggtgaacaagagccgcacgcgcttccgcatcccttggaagcacggcctacggcaggatgcacagcaggaggatttcggaatcttccaggcctgggccg Show more
Description: A cloning plasmid for the IRF3 gene.

IRF3 Rabbit pAb
A2172-100ul	Abclonal	100 ul	EUR 308

IRF3 Rabbit pAb
A2172-200ul	Abclonal	200 ul	EUR 459

IRF3 Rabbit pAb
A2172-20ul	Abclonal	20 ul	EUR 183

IRF3 Rabbit pAb
A2172-50ul	Abclonal	50 ul	EUR 223

IRF3 Polyclonal Antibody
ABP57604-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthetic peptide from human protein at AA range: 1268-1341 Applications tips:
Description: A polyclonal antibody for detection of IRF3 from Human. This IRF3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1268-1341

IRF3 Polyclonal Antibody
ABP57604-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthetic peptide from human protein at AA range: 1268-1341 Applications tips:
Description: A polyclonal antibody for detection of IRF3 from Human. This IRF3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1268-1341

IRF3 Polyclonal Antibody
ABP57604-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic peptide from human protein at AA range: 1268-1341 Applications tips:
Description: A polyclonal antibody for detection of IRF3 from Human. This IRF3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1268-1341

IRF3 Polyclonal Antibody
ABP57605-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthetic peptide from human protein at AA range: 1268-1341 Applications tips:
Description: A polyclonal antibody for detection of IRF3 from Human. This IRF3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1268-1341

IRF3 Polyclonal Antibody
ABP57605-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthetic peptide from human protein at AA range: 1268-1341 Applications tips:
Description: A polyclonal antibody for detection of IRF3 from Human. This IRF3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1268-1341

IRF3 Polyclonal Antibody
ABP57605-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthetic peptide from human protein at AA range: 1268-1341 Applications tips:
Description: A polyclonal antibody for detection of IRF3 from Human. This IRF3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1268-1341

IRF3 Polyclonal Antibody
ES8597-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IRF3 from Human. This antibody is tested and validated for IHC, WB, ELISA

IRF3 Polyclonal Antibody
ES8597-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IRF3 from Human. This antibody is tested and validated for IHC, WB, ELISA

IRF3 sgRNA RISPR Lentivirus (Human)