December 4, 2020

Infectious Agents Identified by Real-Time PCR

lembcke.dk

Infectious Agents Identified by Real-Time PCR, Serology and Bacteriology in Blood and Peritoneal Exudate Samples of Cows Affected by Parietal Fibrinous Peritonitis after Caesarean Section

The aim of this study was to identify the pathogens potentially involved in parietal fibrinous peritonitis (PFP). PFP is a complication of laparotomy in cattle, characterized by an accumulation of exudate inside a fibrinous capsule. We have studied 72 cases of PFP in Belgian blue cows, confirmed by a standard diagnostic protocol. Blood was collected to evaluate the presence of antibodies for Mycoplasma bovis(M. bovis)Coxiella burnetii(C. burnetii) and Bovine Herpesvirus 4(BoHV4) by enzyme-linked immunosorbent assays.
Peritoneal exudate was obtained from the PFP cavity to perform bacteriological culture, and to identify the DNA of MbovisCburnetii and BoHV4 using real time polymerase chain reaction (qPCR). Bacteriological culture was positive in most peritoneal samples (59/72); Trueperella pyogenes (T. pyogenes) (51/72) and Escherichia coli (E. coli) (20/72) were the most frequently identified. For BoHV4, the majority of cows showed positive serology and qPCR (56/72 and 49/72, respectively).
Contrariwise, M. bovis (17/72 and 6/72, respectively) and C. burnetii (15/72 and 6/72, respectively) were less frequently detected (p < 0.0001). Our study proves that PFP can no longer be qualified as a sterile inflammation. Moreover, we herein describe the first identification of BoHV4 and C. burnetii in cows affected by PFP.

lembcke.dk

Carnosic Acid
2075-25
EUR 436
Carnosic Acid
2075-5
EUR 147
Lithocholic acid
2187-1G
EUR 115
Lithocholic acid
2187-5G
EUR 272
Heptelidic Acid
2215-1000
EUR 490
Heptelidic Acid
2215-250
EUR 218
Retinoic acid
2218-250
EUR 338
Retinoic acid
2218-50
EUR 126
Kainic acid
2279-25
EUR 381
Kainic acid
2279-5
EUR 142
Caffeic acid
2303-250
EUR 196
Caffeic acid
2303-50
EUR 98
(+)-Abscisic acid
2543-1
EUR 120
(+)-Abscisic acid
2543-5
EUR 316
Itaconic acid
2576-1G
EUR 120
Itaconic acid
2576-5G
EUR 240
Gambogic acid
2785-25
EUR 544
Gambogic acid
2785-5
EUR 175
Chenodeoxycholic acid
2831-1G
EUR 120
Chenodeoxycholic acid
2831-25G
EUR 479
Chenodeoxycholic acid
2831-5G
EUR 185
Anacardic Acid
A160-10MG 10mg
EUR 120
Anacardic Acid
A160-250MG 250mg
EUR 249
Asterric Acid
A132-1MG 1 mg
EUR 261
Asterric Acid
A132-5MG 5 mg
EUR 839
Zoledronic Acid
A1352-100 100 mg
EUR 224
Description: Zoledronic acid, one of the most potent nitrogen-containing bisphosphonates, induces anti-proliferative and apoptotic effects on multiple myeloma cell lines in vitro by activating protein kinase C. Zoledronic acid also inhibits proliferation of human foet
Zoledronic Acid
A1352-25 25 mg
EUR 108
Description: Zoledronic acid, one of the most potent nitrogen-containing bisphosphonates, induces anti-proliferative and apoptotic effects on multiple myeloma cell lines in vitro by activating protein kinase C. Zoledronic acid also inhibits proliferation of human foet
Zoledronic Acid
A1352-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Zoledronic acid, one of the most potent nitrogen-containing bisphosphonates, induces anti-proliferative and apoptotic effects on multiple myeloma cell lines in vitro by activating protein kinase C. Zoledronic acid also inhibits proliferation of human foet
Arachidonic Acid
1505-100
EUR 169
Aurintricarboxylic acid
1506-1000
EUR 137
Okadaic acid
1543-025
EUR 157
Okadaic acid
1543-100
EUR 316
Betulinic acid
1552-100
EUR 375
Betulinic acid
1552-25
EUR 142
Oleanolic Acid
1731-100
EUR 115
Oleanolic Acid
1731-500
EUR 332
Rosmarinic Acid
1843-250
EUR 229
Rosmarinic Acid
1843-50
EUR 115
Anacardic Acid
1849-25
EUR 370
Anacardic Acid
1849-5
EUR 147
Mycophenolic Acid
1882-250
EUR 294
Mycophenolic Acid
1882-50
EUR 115
ICG acid
189 5 mg
EUR 219
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501
Pressinoic Acid
5-01806 4 x 5mg Ask for price
MB acid
40076 5MG
EUR 320
Description: Minimum order quantity: 1 unit of 5MG
Niflumic acid
B1530-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Niflumic acid, a Ca2+-activated Cl- channel blocker, is an analgesic and anti-inflammatory agent used in the treatment of rheumatoid arthritis.Niflumic acid, an inhibitor of calcium-activated chloride currents. Niflumic acid does not block directly calciu
Niflumic acid
B1530-50 50 mg
EUR 128
Description: Niflumic acid, a Ca2+-activated Cl- channel blocker, is an analgesic and anti-inflammatory agent used in the treatment of rheumatoid arthritis.Niflumic acid, an inhibitor of calcium-activated chloride currents. Niflumic acid does not block directly calciu
Niflumic acid
B1530-S Evaluation Sample
EUR 81
Description: Niflumic acid, a Ca2+-activated Cl- channel blocker, is an analgesic and anti-inflammatory agent used in the treatment of rheumatoid arthritis.Niflumic acid, an inhibitor of calcium-activated chloride currents. Niflumic acid does not block directly calciu
Benzoic Acid
B1676-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Benzoic acid is a colorless crystalline solid and a simple aromatic carboxylic acid, used as a food preservative.
Benzoic Acid
B1676-50 50 mg
EUR 128
Description: Benzoic acid is a colorless crystalline solid and a simple aromatic carboxylic acid, used as a food preservative.
Clofibric Acid
B1711-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Clofibric acid is a PPAR? agonist and hypolipidemic agent.
Clofibric Acid
B1711-50 50 mg
EUR 128
Description: Clofibric acid is a PPAR? agonist and hypolipidemic agent.
Flufenamic acid
B1760-100000 100 g
EUR 187
Description: Flufenamic acid
Flufenamic acid
B1760-250000 250 g
EUR 325
Description: Flufenamic acid
Flufenamic acid
B1760-50000 50 g
EUR 125
Description: Flufenamic acid
Tranexamic Acid
B1858-10000 10 g
EUR 142
Description: Tranexamic acid (Transamin) is an antifibrinolytic for blocking lysine-binding sites of plasmin and elastase-derived plasminogen fragments with IC50 of 5 mM.
Tranexamic Acid
B1858-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Tranexamic acid (Transamin) is an antifibrinolytic for blocking lysine-binding sites of plasmin and elastase-derived plasminogen fragments with IC50 of 5 mM.
Tranexamic Acid
B1858-50 50 mg
EUR 96
Description: Tranexamic acid (Transamin) is an antifibrinolytic for blocking lysine-binding sites of plasmin and elastase-derived plasminogen fragments with IC50 of 5 mM.
Tranexamic Acid
B1858-5000 5 g
EUR 108
Description: Tranexamic acid (Transamin) is an antifibrinolytic for blocking lysine-binding sites of plasmin and elastase-derived plasminogen fragments with IC50 of 5 mM.
Tropodithietic Acid
B1867-1
EUR 251
Oseltamivir Acid
B1886-1
EUR 131
Oseltamivir Acid
B1886-5
EUR 349
Obeticholic Acid
B1898-25
EUR 381
Obeticholic Acid
B1898-5
EUR 142
Chenodeoxycholic Acid
B1908-100 100 mg
EUR 96
Description: Chenodeoxycholic Acid (CDCA), is a hydrophobic primary bile acid that activates nuclear receptors(FXR) involved in cholesterol metabolism.
Chenodeoxycholic Acid
B1908-1000 1 g
EUR 108
Description: Chenodeoxycholic Acid (CDCA), is a hydrophobic primary bile acid that activates nuclear receptors(FXR) involved in cholesterol metabolism.
Chenodeoxycholic Acid
B1908-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Chenodeoxycholic Acid (CDCA), is a hydrophobic primary bile acid that activates nuclear receptors(FXR) involved in cholesterol metabolism.
Chenodeoxycholic Acid
B1908-5000 5 g
EUR 224
Description: Chenodeoxycholic Acid (CDCA), is a hydrophobic primary bile acid that activates nuclear receptors(FXR) involved in cholesterol metabolism.
Bempedoic acid
B1913-25
EUR 544
Bempedoic acid
B1913-5
EUR 175
Cyclamic acid
B1921-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Cyclamic acid in the form of its sodium or calcium salt is one of the most widely used artificial sweeteners.
Cyclamic acid
B1921-50 50 mg
EUR 128
Description: Cyclamic acid in the form of its sodium or calcium salt is one of the most widely used artificial sweeteners.
Cyclamic acid
B1921-S Evaluation Sample
EUR 81
Description: Cyclamic acid in the form of its sodium or calcium salt is one of the most widely used artificial sweeteners.
Mycophenolic acid
B1981-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Mycophenolic acid
Mycophenolic acid
B1981-50 50 mg
EUR 128
Description: Mycophenolic acid
Mycophenolic acid
B1981-S Evaluation Sample
EUR 81
Description: Mycophenolic acid
Nalidixic acid
B1985-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Nalidixic acid
Nalidixic acid
B1985-50 50 mg
EUR 128
Description: Nalidixic acid
Nalidixic acid
B1985-S Evaluation Sample
EUR 81
Description: Nalidixic acid
Nicotinic Acid
B1987-100000 100 g
EUR 108
Description: Niacin (Vitamin B3) is a water-soluble vitamin and is part of the vitamin B group.
Nicotinic Acid
B1987-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Niacin (Vitamin B3) is a water-soluble vitamin and is part of the vitamin B group.
Nicotinic Acid
B1987-50 50 mg
EUR 96
Description: Niacin (Vitamin B3) is a water-soluble vitamin and is part of the vitamin B group.
Nicotinic Acid
B1987-500000 500 g
EUR 224
Description: Niacin (Vitamin B3) is a water-soluble vitamin and is part of the vitamin B group.
Aspterric acid
B2233-1
EUR 370
Aspterric acid
B2233-5
EUR 1240
Gibberellic acid
B2234-1G
EUR 120
Gibberellic acid
B2234-5G
EUR 327
Fusidic acid
B2392-100
EUR 120
Fusidic acid
B2392-500
EUR 240
Carglumic acid
B2447-10
EUR 109
Carglumic acid
B2447-50
EUR 229
Eicosapentaenoic Acid
B3464-100 100 mg
EUR 116
Obeticholic Acid
B4888-100 100 mg
EUR 595
Description: Obeticholic Acid (6alpha-ethyl-chenodeoxycholic acid, 6-ECDCA, INT-747) is a potent and selective agonist of FXR with EC50 value of 99 nM [1].
Obeticholic Acid
B4888-25 25 mg
EUR 282
Description: Obeticholic Acid (6alpha-ethyl-chenodeoxycholic acid, 6-ECDCA, INT-747) is a potent and selective agonist of FXR with EC50 value of 99 nM [1].
Obeticholic Acid
B4888-5 5 mg
EUR 108
Description: Obeticholic Acid (6alpha-ethyl-chenodeoxycholic acid, 6-ECDCA, INT-747) is a potent and selective agonist of FXR with EC50 value of 99 nM [1].
Obeticholic Acid
B4888-5.1 10 mM (in 1mL DMSO)
EUR 113
Description: Obeticholic Acid (6alpha-ethyl-chenodeoxycholic acid, 6-ECDCA, INT-747) is a potent and selective agonist of FXR with EC50 value of 99 nM [1].
Salicylic acid
B1092-10000 10 g
EUR 119
Description: Salicylic acid is a natural product extract from Willow bark, well known as an antiinflammatory inhibitor of cyclooxygenase activity.
Salicylic acid
B1092-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Salicylic acid is a natural product extract from Willow bark, well known as an antiinflammatory inhibitor of cyclooxygenase activity.
Salicylic acid
B1092-50000 50 g
EUR 142
Description: Salicylic acid is a natural product extract from Willow bark, well known as an antiinflammatory inhibitor of cyclooxygenase activity.
Orotic acid
B1147-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Orotic acid (OA) is an intermediate in pyrimidine metabolism.
Orotic acid
B1147-500 500 mg
EUR 108
Description: Orotic acid (OA) is an intermediate in pyrimidine metabolism.
Ellagic Acid
B1154-100
EUR 109
Ellagic Acid
B1154-500
EUR 240
Valproic acid
B1251-10000 10 g
EUR 189
Description: Valproic acid is an inhibitor of HDAC1 with IC50 value of 0.4mM [1].Valproic acid (VPA) is a branched short-chain fatty acid. It is previously synthesized and used as an inert solvent of organic compounds.
Valproic acid
B1251-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Valproic acid is an inhibitor of HDAC1 with IC50 value of 0.4mM [1].Valproic acid (VPA) is a branched short-chain fatty acid. It is previously synthesized and used as an inert solvent of organic compounds.
Valproic acid
B1251-5000 5 g
EUR 142
Description: Valproic acid is an inhibitor of HDAC1 with IC50 value of 0.4mM [1].Valproic acid (VPA) is a branched short-chain fatty acid. It is previously synthesized and used as an inert solvent of organic compounds.
Mefenamic Acid
B1449-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Mefenamic acid is a non-steroidal anti-inflammatory agent, which is an inhibitor of cyclooxygenase.Mefenamic acid is a non-steroidal anti-inflammatory drug used to treat pain, including menstrual pain. It is typically prescribed for oral administration. M
Mefenamic Acid
B1449-50 50 mg
EUR 128
Description: Mefenamic acid is a non-steroidal anti-inflammatory agent, which is an inhibitor of cyclooxygenase.Mefenamic acid is a non-steroidal anti-inflammatory drug used to treat pain, including menstrual pain. It is typically prescribed for oral administration. M
Mefenamic Acid
B1449-S Evaluation Sample
EUR 81
Description: Mefenamic acid is a non-steroidal anti-inflammatory agent, which is an inhibitor of cyclooxygenase.Mefenamic acid is a non-steroidal anti-inflammatory drug used to treat pain, including menstrual pain. It is typically prescribed for oral administration. M
Tolfenamic Acid
B1455-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Tolfenamic acid (TA) is one of the class of non-steroidal anti-inflammatory drugs (NSAIDs).Tolfenamic acid is a NSAID. Tolfenamic acid treatment inhibited cell growth and induced apoptosis as measured by caspase activity and bioelectric impedance. Tolfena
Tolfenamic Acid
B1455-50 50 mg
EUR 102
Description: Tolfenamic acid (TA) is one of the class of non-steroidal anti-inflammatory drugs (NSAIDs).Tolfenamic acid is a NSAID. Tolfenamic acid treatment inhibited cell growth and induced apoptosis as measured by caspase activity and bioelectric impedance. Tolfena
Tolfenamic Acid
B1455-S Evaluation Sample
EUR 81
Description: Tolfenamic acid (TA) is one of the class of non-steroidal anti-inflammatory drugs (NSAIDs).Tolfenamic acid is a NSAID. Tolfenamic acid treatment inhibited cell growth and induced apoptosis as measured by caspase activity and bioelectric impedance. Tolfena
Grifolic acid
B5647-.5 500 µg
EUR 142
Grifolic acid
B5647-1 1 mg
EUR 203
Suberohydroxamic Acid
B5976-1000 1 g
EUR 241
Description: Suberohydroxamic Acid (Suberoyl bis-hydroxamic acid, SBHA) is an inhibitor of HDAC with ID50 values of 0.25 and 0.30 ?M for HDAC1 and HDAC3, respectively [1].
Suberohydroxamic Acid
B5976-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Suberohydroxamic Acid (Suberoyl bis-hydroxamic acid, SBHA) is an inhibitor of HDAC with ID50 values of 0.25 and 0.30 ?M for HDAC1 and HDAC3, respectively [1].
Suberohydroxamic Acid
B5976-500 500 mg
EUR 166
Description: Suberohydroxamic Acid (Suberoyl bis-hydroxamic acid, SBHA) is an inhibitor of HDAC with ID50 values of 0.25 and 0.30 ?M for HDAC1 and HDAC3, respectively [1].
Fenofibric acid
B6128-100 100 mg
EUR 128
Fenofibric acid
B6128-500 500 mg
EUR 290
Oxolinic acid
B6129-10000 10 g
EUR 206
Description: IC50: 4.3 ?M for dopamine uptakeOxolinic acid is a quinolone antibiotic inhibiting bacterial DNA gyrase.DNA gyrase, an enzyme within the class of topoisomerase, relieves strain while double-stranded DNA is being unwound by helicase.
Oxolinic acid
B6129-25000 25 g
EUR 398
Description: IC50: 4.3 ?M for dopamine uptakeOxolinic acid is a quinolone antibiotic inhibiting bacterial DNA gyrase.DNA gyrase, an enzyme within the class of topoisomerase, relieves strain while double-stranded DNA is being unwound by helicase.

Identification of the RNase-binding site of SARS-CoV-2 RNA for anchor primer-PCR detection of viral loading in 306 COVID-19 patients

The pandemic of coronavirus disease 2019 (COVID-19) urgently calls for more sensitive molecular diagnosis to improve sensitivity of current viral nuclear acid detection. We have developed an anchor primer (AP)-based assay to improve viral RNA stability by bioinformatics identification of RNase-binding site of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) RNA and implementing AP dually targeting the N gene of SARS-CoV-2 RNA and RNase 1, 3, 6.
The arbitrarily primed polymerase chain reaction (AP-PCR) improvement of viral RNA integrity was supported by (a) the AP increased resistance of the targeted gene (N gene) of SARS-CoV-2 RNA to RNase treatment; (b) the detection of SARS-CoV-2 RNA by AP-PCR with lower cycle threshold values (-2.7 cycles) compared to two commercially available assays; (c) improvement of the viral RNA stability of the ORF gene upon targeting of the N gene and RNase. Furthermore, the improved sensitivity by AP-PCR was demonstrated by detection of SARS-CoV-2 RNA in 70-80% of sputum, nasal, pharyngeal swabs and feces and 36% (4/11) of urine of the confirmed cases (n = 252), 7% convalescent cases (n = 54) and none of 300 negative cases. Lastly, AP-PCR analysis of 306 confirmed and convalescent cases revealed prolonged presence of viral loading for >20 days after the first positive diagnosis.
Thus, the AP dually targeting SARS-CoV-2 RNA and RNase improves molecular detection by preserving SARS-CoV-2 RNA integrity and reveals the prolonged viral loading associated with older age and male gender in COVID-19 patients.

Rapid and Efficient Colony-PCR for High Throughput Screening of Genetically Transformed Chlamydomonas reinhardtii

Microalgae biotechnologies are rapidly developing into new commercial settings. Several high value products already exist on the market, and biotechnological development is focused on genetic engineering of microalgae to open up future economic opportunities for food, fuel and pharmacological production. Colony-polymerase chain reaction (colony-PCR or cPCR) is a critical method for screening genetically transformed microalgae cells.
However, the ability to rapidly screen thousands of transformants using the current colony-PCR method, becomes a very laborious and time-consuming process. Herein, the non-homologous transformation of Chlamydomonas reinhardtii using the electroporation and glass beads methods generated more than seven thousand transformants. In order to manage this impressive number of clones efficiently, we developed a high-throughput screening (HTS) cPCR method to rapidly maximize the detection and selection of positively transformed clones.
For this, we optimized the Chlamydomonas transformed cell layout on the culture media to improve genomic DNA extraction and cPCR in 96-well plate. The application of this optimized HTS cPCR method offers a rapid, less expensive and reliable method for the detection and selection of microalgae transformants.
Our method, which saves up to 80% of the experimental time, holds promise for evaluating genetically transformed cells and selection for microalgae-based biotechnological applications such as synthetic biology and metabolic engineering.
ART5 Antibody
1-CSB-PA836246LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ART5. Recognizes ART5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:100-1:1000
ART5 Antibody
1-CSB-PA002159GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ART5. Recognizes ART5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
ART5 Antibody
1-CSB-PA889866
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ART5. Recognizes ART5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300
ART5 Antibody
1-CSB-PA219850
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ART5. Recognizes ART5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300
ART5 antibody
70R-5344 50 ug
EUR 467
Description: Rabbit polyclonal ART5 antibody raised against the middle region of ART5
Art5/ Rat Art5 ELISA Kit
ELI-20661r 96 Tests
EUR 886
ART5 Conjugated Antibody
C36155 100ul
EUR 397
ART5 Polyclonal Antibody
A66466 100 µg
EUR 570.55
Description: fast delivery possible
anti- ART5 antibody
FNab00615 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ADP-ribosyltransferase 5
  • Uniprot ID: Q96L15
  • Gene ID: 116969
  • Research Area: Metabolism
Description: Antibody raised against ART5
Anti-ART5 antibody
PAab00615 100 ug
EUR 386
Anti-ART5 antibody
STJ29226 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the ARG-specific ADP-ribosyltransferase family. Proteins in this family regulate the function of target proteins by attaching ADP-ribose to specific amino acid residues in their target proteins. The mouse homolog lacks a glycosylphosphatidylinositol-anchor signal sequence and is predicted to be a secretory enzyme. Several transcripts encoding different isoforms have been found for this gene.
ART5 siRNA
20-abx900464
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ART5 siRNA
20-abx908254
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ART5 siRNA
20-abx908255
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-ART5
YF-PA21994 50 ul
EUR 363
Description: Mouse polyclonal to ART5
anti-ART5
YF-PA21995 50 ug
EUR 363
Description: Mouse polyclonal to ART5
anti-ART5
YF-PA21996 50 ul
EUR 363
Description: Mouse polyclonal to ART5
anti-ART5
YF-PA21997 50 ug
EUR 363
Description: Mouse polyclonal to ART5
ART5 Antibody, HRP conjugated
1-CSB-PA836246LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ART5. Recognizes ART5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ART5 Antibody, FITC conjugated
1-CSB-PA836246LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ART5. Recognizes ART5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ART5 Antibody, Biotin conjugated
1-CSB-PA836246LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ART5. Recognizes ART5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
ART5 Blocking Peptide
33R-9536 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ART5 antibody, catalog no. 70R-5344
ART5 cloning plasmid
CSB-CL836246HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 879
  • Sequence: atggcgctggcggctttgatgatcgccctcggcagcctcggcctccacacctggcaggcccaggctgttcccaccatcctgcccctgggcctggctccagacacctttgacgatacctatgtgggttgtgtagaggagatggaggagaaggcagcccccctgctaaaggaggaaat
  • Show more
Description: A cloning plasmid for the ART5 gene.
ART5 Rabbit pAb
A7146-100ul 100 ul
EUR 308
ART5 Rabbit pAb
A7146-200ul 200 ul
EUR 459
ART5 Rabbit pAb
A7146-20ul 20 ul
EUR 183
ART5 Rabbit pAb
A7146-50ul 50 ul
EUR 223
ADP-Ribosyltransferase 5 (ART5) Antibody
20-abx006905
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
ADP-Ribosyltransferase 5 (ART5) Antibody
20-abx212387
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
ADP-Ribosyltransferase 5 (ART5) Antibody
20-abx212388
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
ADP-Ribosyltransferase 5 (ART5) Antibody
20-abx110890
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
ADP-Ribosyltransferase 5 (ART5) Antibody
abx030620-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
ADP-Ribosyltransferase 5 (ART5) Antibody
abx030620-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
ART5 Polyclonal Antibody, HRP Conjugated
A66467 100 µg
EUR 570.55
Description: reagents widely cited
ART5 Polyclonal Antibody, FITC Conjugated
A66468 100 µg
EUR 570.55
Description: Ask the seller for details
ART5 Polyclonal Antibody, Biotin Conjugated
A66469 100 µg
EUR 570.55
Description: The best epigenetics products
ART5 ELISA KIT|Human
EF007924 96 Tests
EUR 689
Rat ART5 shRNA Plasmid
20-abx988042
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ART5 shRNA Plasmid
20-abx964539
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ART5 shRNA Plasmid
20-abx969241
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ART5 Recombinant Protein (Human)
RP001990 100 ug Ask for price
ART5 Recombinant Protein (Mouse)
RP117383 100 ug Ask for price
ART5 Recombinant Protein (Rat)
RP191087 100 ug Ask for price
Ecto-ADP-Ribosyltransferase 5 (ART5) Antibody
20-abx302484
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ecto-ADP-Ribosyltransferase 5 (ART5) Antibody
abx230615-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Ecto-ADP-Ribosyltransferase 5 (ART5) Antibody (HRP)
20-abx309159
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ecto-ADP-Ribosyltransferase 5 (ART5) Antibody (FITC)
20-abx309160
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ecto-ADP-Ribosyltransferase 5 (ART5) Antibody (Biotin)
20-abx309161
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Art5 ORF Vector (Rat) (pORF)
ORF063697 1.0 ug DNA
EUR 506
ART5 ORF Vector (Human) (pORF)
ORF000664 1.0 ug DNA
EUR 95
Art5 ORF Vector (Mouse) (pORF)
ORF039129 1.0 ug DNA
EUR 506
Art5 sgRNA CRISPR Lentivector set (Mouse)
K4792201 3 x 1.0 ug
EUR 339
Art5 sgRNA CRISPR Lentivector set (Rat)
K7389301 3 x 1.0 ug
EUR 339
ART5 sgRNA CRISPR Lentivector set (Human)
K0129401 3 x 1.0 ug
EUR 339
Human ADP-Ribosyltransferase 5 (ART5) ELISA Kit
20-abx385881
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Art5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4792202 1.0 ug DNA
EUR 154
Art5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4792203 1.0 ug DNA
EUR 154
Art5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4792204 1.0 ug DNA
EUR 154
Art5 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7389302 1.0 ug DNA
EUR 154
Art5 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7389303 1.0 ug DNA
EUR 154
Art5 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7389304 1.0 ug DNA
EUR 154
ART5 sgRNA CRISPR Lentivector (Human) (Target 1)
K0129402 1.0 ug DNA
EUR 154
ART5 sgRNA CRISPR Lentivector (Human) (Target 2)
K0129403 1.0 ug DNA
EUR 154
ART5 sgRNA CRISPR Lentivector (Human) (Target 3)
K0129404 1.0 ug DNA
EUR 154
ART5 Protein Vector (Mouse) (pPB-C-His)
PV156514 500 ng
EUR 603
ART5 Protein Vector (Mouse) (pPB-N-His)
PV156515 500 ng
EUR 603
ART5 Protein Vector (Mouse) (pPM-C-HA)
PV156516 500 ng
EUR 603
ART5 Protein Vector (Mouse) (pPM-C-His)
PV156517 500 ng
EUR 603
ART5 Protein Vector (Rat) (pPB-C-His)
PV254786 500 ng
EUR 603
ART5 Protein Vector (Rat) (pPB-N-His)
PV254787 500 ng
EUR 603
ART5 Protein Vector (Rat) (pPM-C-HA)
PV254788 500 ng
EUR 603
ART5 Protein Vector (Rat) (pPM-C-His)
PV254789 500 ng
EUR 603
ART5 Protein Vector (Human) (pPB-His-MBP)
PV324090 500 ng
EUR 329
ART5 Protein Vector (Human) (pPB-His-GST)
PV324091 500 ng
EUR 329
ART5 Protein Vector (Human) (pPB-C-His)
PV002653 500 ng
EUR 329
ART5 Protein Vector (Human) (pPB-N-His)
PV002654 500 ng
EUR 329
ART5 Protein Vector (Human) (pPM-C-HA)
PV002655 500 ng
EUR 329
ART5 Protein Vector (Human) (pPM-C-His)
PV002656 500 ng
EUR 329
Human ADP Ribosyltransferase 5(ART5)ELISA Kit
QY-E05168 96T
EUR 400
Art5 3'UTR GFP Stable Cell Line
TU152174 1.0 ml Ask for price
Art5 3'UTR Luciferase Stable Cell Line
TU102174 1.0 ml Ask for price
Art5 3'UTR Luciferase Stable Cell Line
TU200944 1.0 ml Ask for price
Art5 3'UTR GFP Stable Cell Line
TU250944 1.0 ml Ask for price
ART5 3'UTR GFP Stable Cell Line
TU051209 1.0 ml
EUR 1394
ART5 3'UTR Luciferase Stable Cell Line
TU001209 1.0 ml
EUR 1394
Bovine Ecto- ADP- ribosyltransferase 5, ART5 ELISA KIT
ELI-20660b 96 Tests
EUR 928
Human Ecto- ADP- ribosyltransferase 5, ART5 ELISA KIT
ELI-44798h 96 Tests
EUR 824
Mouse Ecto- ADP- ribosyltransferase 5, Art5 ELISA KIT
ELI-44883m 96 Tests
EUR 865
ART5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV656155 1.0 ug DNA
EUR 514
ART5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV656159 1.0 ug DNA
EUR 514
ART5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV656160 1.0 ug DNA
EUR 514
ART5 Protein Vector (Human) (pPM-N-D-C-HA)
PV324092 500 ng
EUR 552
ART5 Protein Vector (Human) (pPM-N-D-C-His)
PV324093 500 ng
EUR 552
Art5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4792205 3 x 1.0 ug
EUR 376
Art5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7389305 3 x 1.0 ug
EUR 376
ART5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0129405 3 x 1.0 ug
EUR 376
Art5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4792206 1.0 ug DNA
EUR 167
Art5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4792207 1.0 ug DNA
EUR 167
Art5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4792208 1.0 ug DNA
EUR 167
Art5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7389306 1.0 ug DNA
EUR 167
Art5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7389307 1.0 ug DNA
EUR 167
Art5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7389308 1.0 ug DNA
EUR 167
ART5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV656156 1.0 ug DNA
EUR 514
ART5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV656157 1.0 ug DNA
EUR 572
ART5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV656158 1.0 ug DNA
EUR 572
ART5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0129406 1.0 ug DNA
EUR 167
ART5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0129407 1.0 ug DNA
EUR 167
ART5 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0129408 1.0 ug DNA
EUR 167
H2B Antibody Antibody
AF4659 200ul
EUR 376
Description: H2B Antibody Antibody detects endogenous levels of H2B.
CD11b Antibody Antibody
ABD2911 100 ug
EUR 438
anti- Antibody^Polyclonal antibody control antibody
LSMab09882 100 ug
EUR 438