December 1, 2020

HAS2 antibody

HAS2 antibody 

To Order Contact us: bjorn@lembcke.dk

Mouse Hyaluronan Synthase 2 (HAS2) ELISA Kit

DLR-HAS2-Mu-96T 96T
EUR 688
  • Should the Mouse Hyaluronan Synthase 2 (HAS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hyaluronan Synthase 2 (HAS2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Hyaluronan Synthase 2 (HAS2) ELISA Kit

RDR-HAS2-Hu-48Tests 48 Tests
EUR 544

Human Hyaluronan Synthase 2 (HAS2) ELISA Kit

RDR-HAS2-Hu-96Tests 96 Tests
EUR 756

Mouse Hyaluronan Synthase 2 (HAS2) ELISA Kit

RDR-HAS2-Mu-48Tests 48 Tests
EUR 557

Mouse Hyaluronan Synthase 2 (HAS2) ELISA Kit

RDR-HAS2-Mu-96Tests 96 Tests
EUR 774

Human Hyaluronan Synthase 2 (HAS2) ELISA Kit

RD-HAS2-Hu-48Tests 48 Tests
EUR 521

Human Hyaluronan Synthase 2 (HAS2) ELISA Kit

RD-HAS2-Hu-96Tests 96 Tests
EUR 723

Mouse Hyaluronan Synthase 2 (HAS2) ELISA Kit

RD-HAS2-Mu-48Tests 48 Tests
EUR 533

Mouse Hyaluronan Synthase 2 (HAS2) ELISA Kit

RD-HAS2-Mu-96Tests 96 Tests
EUR 740

HAS2 Antibody

48457-100ul 100ul
EUR 333

HAS2 Antibody

48457-50ul 50ul
EUR 239

HAS2 Antibody

BF0034 200ul
EUR 376
Description: HAS2 antibody detects endogenous levels of total HAS2.

HAS2 Antibody

1-CSB-PA010140LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HAS2. Recognizes HAS2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

Has2 Antibody

1-CSB-PA010140LA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Has2. Recognizes Has2 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

HAS2 Conjugated Antibody

C48457 100ul
EUR 397

Polyclonal HAS2 antibody

AMM05456G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HAS2 . This antibody is tested and proven to work in the following applications:

Has2 Polyclonal Antibody

A55086 100 µg
EUR 570.55
Description: The best epigenetics products

Anti-HAS2 antibody

STJ111939 100 µl
EUR 277
Description: Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS2 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to glycosaminoglycan synthetase (DG42) from Xenopus laevis, and human and murine hyaluronan synthase 1.

Has2/ Rat Has2 ELISA Kit

ELI-03764r 96 Tests
EUR 886

HAS2 siRNA

20-abx902414
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HAS2 siRNA

20-abx919089
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HAS2 siRNA

20-abx919090
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal HAS2 Antibody (Center)

APG03030G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HAS2 (Center). This antibody is tested and proven to work in the following applications:

HAS2 Antibody, HRP conjugated

1-CSB-PA010140LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HAS2. Recognizes HAS2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

Has2 Antibody, HRP conjugated

1-CSB-PA010140LB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Has2. Recognizes Has2 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

HAS2 Antibody, FITC conjugated

1-CSB-PA010140LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HAS2. Recognizes HAS2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

Has2 Antibody, FITC conjugated

1-CSB-PA010140LC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Has2. Recognizes Has2 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

HAS2 Antibody, Biotin conjugated

1-CSB-PA010140LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HAS2. Recognizes HAS2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Has2 Antibody, Biotin conjugated

1-CSB-PA010140LD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Has2. Recognizes Has2 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

HAS2 Blocking Peptide

BF0034-BP 1mg
EUR 195

HAS2 cloning plasmid

CSB-CL010140HU-10ug 10ug
EUR 574
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1659
  • Sequence: ATGCATTGTGAGAGGTTTCTATGTATCCTGAGAATAATTGGAACCACACTCTTTGGAGTCTCTCTCCTCCTTGGAATCACAGCTGCTTATATTGTTGGCTACCAGTTTATCCAAACGGATAATTACTATTTCTCTTTTGGACTGTATGGTGCCTTTTTGGCATCACACCTCATCA
  • Show more
Description: A cloning plasmid for the HAS2 gene.

HAS2 Rabbit pAb

A9897-100ul 100 ul
EUR 308

HAS2 Rabbit pAb

A9897-200ul 200 ul
EUR 459

HAS2 Rabbit pAb

A9897-20ul 20 ul
EUR 183

HAS2 Rabbit pAb

A9897-50ul 50 ul
EUR 223

HAS2 antibody