December 4, 2020
lembcke.dk

focused methodology to disclose host particular malacosporean an infection profiles

PCR-RFLP: a focused methodology to disclose host particular malacosporean an infection profiles (Cnidaria: Myxozoa: Malacosporea)

Malacosporeans are a bunch of endoparasitic cnidarians (Myxozoa) that use freshwater bryozoans and fish as last and intermediate hosts, respectively. The malacosporean Tetracapsuloides bryosalmonae causes proliferative kidney illness (PKD), an rising illness in aquaculture and wild fish populations, together with threatened salmonids in Europe and the USA.
Combined infections of malacosporeans are sometimes encountered, and a monitoring software for screening of a number of malacosporean species in both their fish or bryozoan hosts is due to this fact fascinating. We describe a cheap methodology that mixes PCR amplification of the partial 18S rRNA gene (~260 bp) and a single-step restriction fragment size polymorphism (RFLP) methodology for identification of 10 malacosporean lineages and species.
We display and take a look at this technique on a set of DNA extracted from malacosporeans infecting fish kidney and tissues sampled from bryozoan colonies and examine the outcomes with Sanger sequencing of the identical parasite DNA isolates. The PCR-RFLP and Sanger sequencing strategies agreed in 100% of circumstances. The PCR-RFLP methodology provides a variety of alternatives, together with screening giant panels of host tissue samples to achieve insights into an infection patterns, characterizing combined infections, and confirming extremely pathogenic T. bryosalmonae infections.
The strategy will also be additional refined as new sequence information turn into accessible for malacosporeans.
lembcke.dk
lembcke.dk
Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
DLR-TPH2-Ra-96T 96T
EUR 718
  • Should the Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Tryptophan Hydroxylase 2 (TPH2) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RDR-TPH2-Hu-48Tests 48 Tests
EUR 544
Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RDR-TPH2-Hu-96Tests 96 Tests
EUR 756
Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RDR-TPH2-Mu-48Tests 48 Tests
EUR 557
Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RDR-TPH2-Mu-96Tests 96 Tests
EUR 774
Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RDR-TPH2-Ra-48Tests 48 Tests
EUR 583
Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RDR-TPH2-Ra-96Tests 96 Tests
EUR 811
Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RD-TPH2-Hu-48Tests 48 Tests
EUR 521
Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RD-TPH2-Hu-96Tests 96 Tests
EUR 723
Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RD-TPH2-Mu-48Tests 48 Tests
EUR 533
Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RD-TPH2-Mu-96Tests 96 Tests
EUR 740
Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RD-TPH2-Ra-48Tests 48 Tests
EUR 557
Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
RD-TPH2-Ra-96Tests 96 Tests
EUR 775
TPH2 antibody
70R-2005 50 ug
EUR 467
Description: Rabbit polyclonal TPH2 antibody raised against the middle region of TPH2
TPH2 antibody
70R-2011 50 ug
EUR 467
Description: Rabbit polyclonal TPH2 antibody raised against the N terminal of TPH2
TPH2 Antibody
43424-100ul 100ul
EUR 252
TPH2 Antibody
1-CSB-PA917997
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:10-1:50
TPH2 Antibody
1-CSB-PA809000LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:5000, IHC:1:20-1:200, IF:1:50-1:200
TPH2 Antibody
DF8732 200ul
EUR 304
Description: TPH2 Antibody detects endogenous levels of total TPH2.
TPH2 Antibody
1-CSB-PA161937
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50
TPH2 Antibody
1-CSB-PA006960
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000
TPH2 antibody
70R-34658 100 ug
EUR 327
Description: Purified Rabbit polyclonal TPH2 antibody
TPH2 Antibody
ABD8732 100 ug
EUR 438
TPH2 antibody (Ser19)
70R-15074 100 ul
EUR 392
Description: Rabbit polyclonal TPH2 antibody (Ser19)
TPH2 antibody (Ser19)
70R-34657 100 ug
EUR 327
Description: Purified Rabbit polyclonal TPH2 antibody (Ser19)
TPH2 antibody (Ser58)
70R-35594 100 ug
EUR 327
Description: Rabbit polyclonal TPH2 antibody (Ser58)
TPH2 Conjugated Antibody
C43424 100ul
EUR 397
TPH2 (pS19) Antibody
abx333346-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.
TPH2 Polyclonal Antibody
ABP53691-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19
  • Applications tips:
Description: A polyclonal antibody for detection of TPH2 from Human, Mouse, Rat, Monkey. This TPH2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19
TPH2 Polyclonal Antibody
ABP53691-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19
  • Applications tips:
Description: A polyclonal antibody for detection of TPH2 from Human, Mouse, Rat, Monkey. This TPH2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19
TPH2 Polyclonal Antibody
ABP53691-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19
  • Applications tips:
Description: A polyclonal antibody for detection of TPH2 from Human, Mouse, Rat, Monkey. This TPH2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the non-phosphorylation site of S19
anti- TPH2 antibody
FNab08885 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: tryptophan hydroxylase 2
  • Uniprot ID: Q8IWU9
  • Gene ID: 121278
  • Research Area: Neuroscience, Signal Transduction, Metabolism
Description: Antibody raised against TPH2
TPH2 Polyclonal Antibody
ES4690-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TPH2 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA
TPH2 Polyclonal Antibody
ES4690-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TPH2 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA
Anti-TPH2 antibody
PAab08885 100 ug
EUR 355
Anti-TPH2 antibody
STJ116731 100 µl
EUR 277
Description: This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression.
Anti-TPH2 antibody
STJ29227 100 µl
EUR 277
Description: This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression.
Anti-TPH2 antibody
STJ96076 200 µl
EUR 197
Description: Rabbit polyclonal to TPH2.
Tph2/ Rat Tph2 ELISA Kit
ELI-07130r 96 Tests
EUR 886
TPH2 siRNA
20-abx905746
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TPH2 siRNA
20-abx937835
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TPH2 siRNA
20-abx937836
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TPH2 (Ab-19) Antibody
33305-100ul 100ul
EUR 252
TPH2 (Ab-19) Antibody
33305-50ul 50ul
EUR 187
TPH2 (Phospho-Ser19) Antibody
11828-100ul 100ul
EUR 252
TPH2 (Phospho-Ser19) Antibody
11828-50ul 50ul
EUR 187
Phospho-TPH2 (Ser19) Antibody
CSB-PA123981-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-TPH2 (Ser19). Recognizes Phospho-TPH2 (Ser19) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000
Phospho-TPH2 (Ser19) Antibody
CSB-PA123981-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-TPH2 (Ser19). Recognizes Phospho-TPH2 (Ser19) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000
TPH2 Antibody, HRP conjugated
1-CSB-PA809000LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TPH2 Antibody, FITC conjugated
1-CSB-PA809000LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TPH2 Antibody, Biotin conjugated
1-CSB-PA809000LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TPH2. Recognizes TPH2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TPH2 (Ab-19) Antibody
CSB-PA272667-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TPH2 (Ab-19). Recognizes TPH2 (Ab-19) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TPH2 (Ab-19) Antibody
CSB-PA272667-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TPH2 (Ab-19). Recognizes TPH2 (Ab-19) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
Phospho-TPH2 (S19) Antibody
1-CSB-PA006958
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-TPH2 (S19). Recognizes Phospho-TPH2 (S19) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000
Anti-Tph2 (mouse) antibody
STJ72618 100 µg
EUR 359
TPH2 Rabbit pAb
A14520-100ul 100 ul
EUR 308
TPH2 Rabbit pAb
A14520-200ul 200 ul
EUR 459
TPH2 Rabbit pAb
A14520-20ul 20 ul
EUR 183
TPH2 Rabbit pAb
A14520-50ul 50 ul
EUR 223
TPH2 Blocking Peptide
33R-4561 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TPH2 antibody, catalog no. 70R-2005
TPH2 Blocking Peptide
33R-7865 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TPH2 antibody, catalog no. 70R-2011
TPH2 Blocking Peptide
DF8732-BP 1mg
EUR 195
TPH2 cloning plasmid
CSB-CL809000HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1491
  • Sequence: ATGCAGCCAGCAATGATGATGTTTTCCAGTAAATACTGGGCACGGAGAGGGTTTTCCCTGGATTCAGCAGTGCCCGAAGAGCATCAGCTACTTGGCAGCTCAACAGCTTCGACATTCCTGAAGCTAAATAAACCTAACTCTGGCAAAAATGACGACAAAGGCAACAAGGGAAGCA
  • Show more
Description: A cloning plasmid for the TPH2 gene.
TPH2 Rabbit pAb
A7147-100ul 100 ul
EUR 308
TPH2 Rabbit pAb
A7147-200ul 200 ul
EUR 459
TPH2 Rabbit pAb
A7147-20ul 20 ul
EUR 183
TPH2 Rabbit pAb
A7147-50ul 50 ul
EUR 223
Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx005394
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx178740
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx178741
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx178742
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.
Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx213944
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx213686
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx129888
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Tryptophan Hydroxylase 2 (TPH2) Antibody
abx145380-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx174958
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx174959
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx013001
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx034260
  • EUR 342.00
  • EUR 523.00
  • 100 ul
  • 400 ul
  • Shipped within 5-10 working days.
Tryptophan Hydroxylase 2 (TPH2) Antibody
abx034260-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Tryptophan Hydroxylase 2 (TPH2) Antibody
abx238885-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
TPH2 (Ab-19) Conjugated Antibody
C33305 100ul
EUR 397
Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx329873
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tryptophan Hydroxylase 2 (TPH2) Antibody
abx331689-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Tryptophan Hydroxylase 2 (TPH2) Antibody
abx430991-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Tryptophan Hydroxylase 2 (Tph2) Antibody
abx431655-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Tryptophan Hydroxylase 2 (TPH2) Antibody
abx431656-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Tryptophan Hydroxylase 2 (TPH2) Antibody
20-abx302298
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
TPH2 (phospho Ser19) Polyclonal Antibody
ABP53690-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human TPH2 around the phosphorylation site of S19
  • Applications tips:
Description: A polyclonal antibody for detection of TPH2 phospho Ser19) from Human, Mouse, Rat. This TPH2 phospho Ser19) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the phosphorylation site of S19
TPH2 (phospho Ser19) Polyclonal Antibody
ABP53690-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human TPH2 around the phosphorylation site of S19
  • Applications tips:
Description: A polyclonal antibody for detection of TPH2 phospho Ser19) from Human, Mouse, Rat. This TPH2 phospho Ser19) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the phosphorylation site of S19
TPH2 (phospho Ser19) Polyclonal Antibody
ABP53690-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human TPH2 around the phosphorylation site of S19
  • Applications tips:
Description: A polyclonal antibody for detection of TPH2 phospho Ser19) from Human, Mouse, Rat. This TPH2 phospho Ser19) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human TPH2 around the phosphorylation site of S19
TPH2 (phospho Ser19) Polyclonal Antibody
ES4689-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TPH2 (phospho Ser19) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
TPH2 (phospho Ser19) Polyclonal Antibody
ES4689-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TPH2 (phospho Ser19) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Anti-Phospho-TPH2 (S19) antibody
STJ90661 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-TPH2 (S19).
Anti-TPH2 (aa16-29) antibody
STJ72617 100 µg
EUR 359
TPH2 (Phospho-Ser19) Polyclonal Conjugated Antibody
C11828 100ul
EUR 397
Tryptophan Hydroxylase 2 (TPH2) Antibody (HRP)
20-abx316362
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tryptophan Hydroxylase 2 (TPH2) Antibody (FITC)
20-abx316363
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tryptophan Hydroxylase 2 (TPH2) Antibody (Biotin)
20-abx316364
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-Tryptophan hydroxylase 2 / TPH2 antibody
STJ70833 100 µg
EUR 359
Human TPH2 ELISA Kit
ELA-E2229h 96 Tests
EUR 824
TPH2 ELISA KIT|Human
EF006246 96 Tests
EUR 689
Rat TPH2 shRNA Plasmid
20-abx989991
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TPH2 shRNA Plasmid
20-abx964667
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TPH2 shRNA Plasmid
20-abx980994
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TPH2 Recombinant Protein (Rat)
RP234368 100 ug Ask for price
TPH2 Recombinant Protein (Human)
RP044410 100 ug Ask for price
TPH2 Recombinant Protein (Mouse)
RP180680 100 ug Ask for price
Polyclonal TPH2 (aa16-29) Antibody (N-Term)
APR13778G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TPH2 (aa16-29) (N-Term). This antibody is tested and proven to work in the following applications:
Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse)
4-PAG343Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2)
Tph2 ORF Vector (Rat) (pORF)
ORF078124 1.0 ug DNA
EUR 506
TPH2 ORF Vector (Human) (pORF)
ORF014804 1.0 ug DNA
EUR 354
Tph2 ORF Vector (Mouse) (pORF)
ORF060228 1.0 ug DNA
EUR 506
Recombinant Tryptophan Hydroxylase 2 (TPH2)
4-RPG343Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8CGV2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 45.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Tryptophan Hydroxylase 2 expressed in: E.coli
pECMV-Tph2-m-FLAG Plasmid
PVT14992 2 ug
EUR 325
Tryptophan Hydroxylase 2 Phospho-Ser19 (TPH2 pS19) Antibody
20-abx012729
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Polyclonal Tryptophan hydroxylase 2 / TPH2 Antibody (internal region)
APR13831G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Tryptophan hydroxylase 2 / TPH2 (internal region). This antibody is tested and proven to work in the following applications:
Tryptophan Hydroxylase 2 Phospho-Ser19 (TPH2 pS19) Antibody
20-abx327772
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), APC
4-PAG343Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with APC.
Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), Biotinylated
4-PAG343Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with Biotin.
Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), Cy3
4-PAG343Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with Cy3.
Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), FITC
4-PAG343Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with FITC.
Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), HRP
4-PAG343Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with HRP.
Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), PE
4-PAG343Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with PE.
Mouse Tryptophan Hydroxylase 2 (TPH2) Protein
20-abx168392
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
TPH2 Colorimetric Cell-Based ELISA Kit
EKC1573 100ul
EUR 572
Human Tryptophan Hydroxylase 2 (TPH2) Protein
20-abx655364
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Rat Tryptophan Hydroxylase 2 (TPH2) Protein
20-abx655365
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
abx595600-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.
Human Tryptophan 5-hydroxylase 2 (TPH2)
1-CSB-CF809000HU
  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 60.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Tryptophan 5-hydroxylase 2(TPH2) expressed in in vitro E.coli expression system
Tph2 sgRNA CRISPR Lentivector set (Rat)
K7297901 3 x 1.0 ug
EUR 339
TPH2 sgRNA CRISPR Lentivector set (Human)
K2428101 3 x 1.0 ug
EUR 339
Tph2 sgRNA CRISPR Lentivector set (Mouse)
K4118401 3 x 1.0 ug
EUR 339
Tryptophan Hydroxylase 2 (TPH2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAG343Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TPH2 (Met1~Ser138)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Tryptophan Hydroxylase 2 (TPH2). This antibody is labeled with APC-Cy7.
Rat Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
20-abx156179
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
20-abx154794
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Tryptophan Hydroxylase 2 (TPH2) ELISA Kit
20-abx153361
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Tryptophan Hydroxylase 2 (TPH2) CLIA Kit
20-abx495166
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Tryptophan Hydroxylase 2 (TPH2) CLIA Kit
20-abx495167
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Rat Tryptophan Hydroxylase 2 (TPH2) CLIA Kit
20-abx495168
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Tph2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7297902 1.0 ug DNA
EUR 154
Tph2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7297903 1.0 ug DNA
EUR 154
Tph2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7297904 1.0 ug DNA
EUR 154
TPH2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2428102 1.0 ug DNA
EUR 154
TPH2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2428103 1.0 ug DNA
EUR 154
TPH2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2428104 1.0 ug DNA
EUR 154
Tph2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4118402 1.0 ug DNA
EUR 154

Analysis of BOX-PCR and REP-PCR as Molecular Typing Instruments for Antarctic Streptomyces

Molecular research led to the resurgence of pure merchandise analysis from genus Streptomyces, already identified for his or her lengthy historical past and significance for the pharmaceutical trade. Nevertheless, species belonging to this genus are troublesome to establish and probably the most generally used strategies, that are primarily based on 16S rRNA sequencing, don’t discriminate between associated species. On this work, amplification profiles generated from BOX-PCR and REP-PCR of 49 Antarctic soil streptomycetes had been in comparison with consider the variety current within the group and to characterize the bacterial isolates, together with some 16S rRNA amplifications.
The BOX-A1R primer exhibit clearer amplification fragments, totally different from the amplification patterns obtained utilizing the REP 1R and 2R primers. A better variety was noticed with REP-PCR amplifications, regardless that a bigger variety of fragments was obtained with BOX-A1R primer amplifications. There are not less than 4 isolates that confirmed nice similarity (about 90%) in each strategies.
In different hand, there are two others which might be 90% related in BOX-PCR, however distant in REP-PCR, exhibiting solely 40% of similarity. Outcomes of the mixture of BOX-PCR and REP-PCR signify a easy and low-cost methodology to discriminate between Streptomyces strains. There isn’t any species identification with solely the 16S rRNA, most isolates appear to be associated to S. globisporus. Additional research added to the obtained outcomes could present higher information to assist the characterization of those microorganisms.

Digital PCR-based plasma cell-free DNA mutation evaluation for early-stage pancreatic tumor analysis and surveillance

Background: Cell-free DNA (cfDNA) shed from tumors into the circulation provides a software for most cancers detection. Right here, we evaluated the feasibility of cfDNA measurement and utility of digital PCR (dPCR)-based assays, which scale back subsampling error, for diagnosing pancreatic ductal adenocarcinoma (PDA) and surveillance of intraductal papillary mucinous neoplasm (IPMN).
Strategies: We collected plasma from seven establishments for cfDNA measurements. Scorching-spot mutations in KRAS and GNAS within the cfDNA from sufferers with PDA (n = 96), present process surveillance for IPMN (n = 112), and regular controls (n = 76) had been evaluated utilizing pre-amplification dPCR.
Outcomes: Upon Qubit measurement and duplicate quantity evaluation of hemoglobin-subunit (HBB) and mitochondrially encoded NADH:ubiquinone oxidoreductase core subunit 1 (MT-ND1) in plasma cfDNA, HBB provided the perfect decision between sufferers with PDA relative to wholesome topics [area under the curve (AUC) 0.862], whereas MT-ND1 revealed vital variations between IPMN and controls (AUC 0.851).
DPCR using pre-amplification cfDNA afforded correct tumor-derived mutant KRAS detection in plasma in resectable PDA (AUC 0.861-0.876) and improved post-resection recurrence prediction [hazard ratio (HR) 3.179, 95% confidence interval (CI) 1.025-9.859] over that for the marker CA19-9 (HR 1.464; 95% CI 0.674-3.181). Capturing KRAS and GNAS may additionally present genetic proof in sufferers with IPMN-associated PDA and present process pancreatic surveillance.
Conclusions: Plasma cfDNA quantification by distinct measurements is helpful to foretell tumor burden. By acceptable strategies, dPCR-mediated mutation detection in sufferers with localized PDA and IPMN prone to progress to invasive carcinoma is possible and enhances typical biomarkers.

Vitamine B9 [HRP]

DAGDT1440-HRP 1mg
EUR 1105

Vitamine B12 [HRP]

DAGT5413-HRP 1mg
EUR 975

GAPDH Antibody - HRP

T0004-HRP 1ml
EUR 920
Description: GAPDH Mouse Monoclonal antibody detects endogenous levels of total GAPDH protein.

HRP-IgG Conjugation Kit

55R-HRP 1 mg
EUR 705
Description: HRP conjugation kit for all types of IgG

beta-Actin Antibody - HRP

T0022-HRP 1ml
EUR 920
Description: beta-Actin Mouse Monoclonal antibody detects endogenous levels of total beta-Actin protein.

Goat Anti-Rat IgG1-HRP Conjugate

50121-HRP 0.5 ml
EUR 225

Goat Anti-Rat IgG2a-HRP Conjugate

50122-HRP 0.5 ml
EUR 225

Goat Anti-Rat IgG2b-HRP Conjugate

50123-HRP 0.5 ml
EUR 225

Goat Anti-Rat IgG2c-HRP Conjugate

50124-HRP 0.5 ml
EUR 225

Monoclonal Anti-Rat IgG1-HRP Conjugate

50126-HRP 0.5 ml
EUR 286

Rabbit Anti-Bird IgM-HRP Conjugate

90521-HRP 100 ul
EUR 347

Concanavalin A Lectin (ConA)-HRP conjugate

CONA15-HRP 0.5 ml
EUR 286

Aleuria Aurantia Lectin (Aal)-HRP conjugate

AAL15-HRP 0.5 ml
EUR 225

Monoclonal Anti-Poly His-HRP conjugate

HISP12-HRP 100 ul
EUR 347

Lens culinaris Lectin (LCA)-HRP conjugate

LCA15-HRP 0.5 ml
EUR 286

Anti-Per.C6Ð’ Affinity Purified HRP, Goat

PC118AF-HRP 1 mg
EUR 4069
  • Product category: Antibodies
Description: Anti-Per.C6Ð’ Affinity Purified HRP, Goat by Cygnus Technologies is available in Europe via Gentaur.

Rabbit Anti-Salmonella IgG-HRP conjugate

SLM11-HRP 0.5 ml
EUR 347

Sambucus nigra Lectin (SNA)-HRP conjugate

SNA15-HRP 0.5 ml
EUR 286

Goat Anti-Donkey IgG (Fc)-HRP conjugate

80950-HRP 0.5 ml
EUR 225

Rabbit Anti-bovine Catalase IgG-HRP Conjugate

CATB11-HRP 100 ul
EUR 469

Sheep Anti-rat albumin IgG-HRP Conjugate

ALBR12-HRP 100 ul
EUR 347

Goat Anti-human lactoferrin IgG-HRP Conjugate

LTF11-HRP 0.5 ml
EUR 445

Goat Anti-bovine lactoferrin IgG-HRP conjugate

LTF13-HRP 0.5 ml
EUR 445

Chicken Anti-Protein-A IgG-HRP conjugate

PRTA13-HRP 100 ul
EUR 347

Recombinant (E.Coli) purified Protein G-HRP Conjugate

PRTG15-HRP 1 ml
EUR 225

Monoclonal Anti-Phosphotyrosine (PY20) IgG-HRP conjugate

PTYR12-HRP 100 ul
EUR 408

Goat Anti-Human Transferrin IgG-HRP conjugate

TF11-HRP 100 ug
EUR 347

Goat Anti-Mouse Transferrin IgG-HRP conjugate

TF14-HRP 100 ug
EUR 347

Wheat germ agglutinin Lectin (WGA)-HRP conjugate

WGA15-HRP 0.5 ml
EUR 286

Goat Anti-Turkey IgG (H+L)-HRP conjugate

60600-HRP 0.5 ml
EUR 225

Goat Anti-Mouse IgG (Fc) IgG-HRP Conjugate

40151-HRP 1 ml
EUR 225

Goat Anti-Diphtheria Toxoid/Toxin IgG-HRP conjugate

DTOX12-HRP 0.5 ml
EUR 408

Rabbit Anti-Donkey IgG (H+L)-HRP conjugate

80920-HRP 1 ml
EUR 213

Rabbit Anti-bovine Adenosine deaminase IgG-HRP conjugate

ADA11-HRP 100 ul
EUR 384

Goat Anti-Human Plasma Fibrinogen IgG-HRP Conjugate

FIBN17-HRP 100 ul
EUR 408

Goat Anti-Luciferase (Fire fly) IgG-HRP Conjugate

LUCF11-HRP 100 ul
EUR 347

Rabbit Anti-Luciferase (Photobacterium fischerii) IgG-HRP Conjugate

LUCF12-HRP 500 ul
EUR 384

Monoclonal Anti-Maltose binding protein (MBP)-HRP conjugate

MBP11-HRP 100 ul
EUR 347

Goat Anti-Human plasminogen protein IgG, HRP conjugate

PLMN12-HRP 100 ul
EUR 408

Ricinus communis (castor bean) Agglutinin (RCA120)-HRP conjugate

RCA15-HRP 0.5 ml
EUR 286

Rabbit Anti-Human alpha-Tubulin IgG-HRP Conjugate

TUBA13-HRP 100 ul
EUR 432

Goat Anti-Adenovirus type 2, hexon IgG-HRP conjugate

ADV11-HRP 0.5 ml
EUR 408

Rabbit anti-Beta-Galactosidase (E. Coli) IgG-HRP conjugate

BGAL12-HRP 100 ul
EUR 347

Goat Anti-Hepatitis Surface Antigen (HBsAg) IgG-HRP Conjugate

HBA11-HRP 1 ml
EUR 347

Mouse Monoclonal Anti-Hepatitis Surface Antigen (HBsAg)-HRP Conjugate

HBA12-HRP 1 ml
EUR 347

Rabbit Anti-human spleen ferrtin protein IgG, HRP conjugate

FERT11-HRP 100 ul
EUR 408

Goat Anti-Poliomyelitis Virus 1-3 IgG-HRP Conjugate

POLV13-HRP 0.5 ml
EUR 408

Goat Anti-Rubella virus (HPV77 strain) IgG-HRP conjugate

RUBL11-HRP 1 ml
EUR 347

HRP Conjugated Avidin

BA1081-0.5 0.5ml
EUR 146

HRP Conjugated Avidin

BA1081-1 1ml
EUR 233

HRP Conjugated Streptavidin

BA1088-0.5 0.5ml
EUR 146

HRP Conjugated Streptavidin

BA1088-1 1ml
EUR 233

Streptavidin HRP Conjugated

LS1012 1.0 ml
EUR 119

Streptavidin, HRP conjugated

S0900-001 1mg
EUR 300

Rabbit Anti-Human beta 2-microglobulin protein IgG, HRP conjugate

B2M11-HRP 100 ul
EUR 408

Rabbit Anti-Bovine Serum Albumin (BSA) protein IgG-HRP Conjugate

ALBB14-HRP 0.5 ml
EUR 347

Goat Anti-Human Alpha 1-Antitrypsin (A1AT) IgG, HRP conjugate

A1AT11-HRP 100 ul
EUR 408

Goat Anti-Hemeagglutinin fusion epitope (HA-tag) IgG-HRP conjugate

HA12-HRP 100 ug
EUR 347

Goat Anti-Glutathione Transferase (GST, S. japonicum) IgG-HRP Conjugate

GST13-HRP 100 ul
EUR 347

Bovine Fetuin (Alpha-2 HS-Glycoprotein, AHSG, A2HS)-HRP Conjugate

FETB15-HRP 500 ul
EUR 286

Rabbit Anti-c-Myc epitope (fusion tag) IgG-HRP conjugate

MYC13-HRP 100 ul
EUR 347

Goat Anti-Human Respiratory Syncytial Virus (RSV) IgG-HRP conjugate

RSV12-HRP 0.5 ml
EUR 469

Monoclonal Anti-Vesicular Stomatitis Virus Glycoprotein (VSV)-IgG-HRP conjugate

VSV11-HRP 100 ul
EUR 347

Goat Anti-human C-Reactive Protein (CRP)-HRP Conjugate, aff pure

CRP11-HRP 100 ug
EUR 408

Goat Anti-human Alpha 2-Macroglobulin (A2M) protein IgG, HRP conjugate

A2MG11-HRP 100 ul
EUR 286

Goat Anti-human Kappa light chain (bound and free)-HRP conjugate

MKUL11-HRP 0.5ml
EUR 213

Rabbit Anti-Vaccinia virus (VACV/VV/small pox) IgG-HRP conjugate

VACV11-HRP 0.5 ml
EUR 408

Rabbit Anti-T7 tag (T7-tag, fusion tag) IgG-HRP Conjugate

T711-HRP 50 ul
EUR 408

Rabbit Anti-Chicken IgG/Y (ab')2 fragment specific IgG-HRP Conjugate

60445-HRP 0.5 ml
EUR 225

Mouse Monoclonal Anti-Human Beta Actin peptide (non-muscle) IgG-HRP Conjugate

ACTB12-HRP 100 ul
EUR 408

Rabbit Anti-rat C-Reactive Protein (CRP) IgG-HRP Conjugate, aff pure

CRP16-HRP 100 ug
EUR 408

Goat Anti-rat C-Reactive Protein (CRP) IgG-HRP Conjugate, aff pure

CRP17-HRP 100 ug
EUR 408

Goat Anti-Dog C-Reactive Protein (CRP) IgG-HRP Conjugate, aff pure

CRP18-HRP 100 ug
EUR 347

Goat Anti-Green Fluorescent Proteins (GFP, A. victoria) protein IgG-HRP conjugate

GFP11-HRP 100 ug
EUR 347

Monoclonal Anti-Green Fluorescent Proteins (GFP, A. victoria) protein IgG-HRP conjugate

GFP12-HRP 0.5 ml
EUR 408

Monoclonal Anti-Rabbit IgG (Light-chain) IgG-HRP Conj (adsorbed, for immunoprecipitation/WB)

20160-HRP 0.5 ml
EUR 263

Rabbit Anti-Human Alpha 1-Acid Glycoprotein (A1-AGP) protein IgG, HRP conjugate

A1AG11-HRP 100 ul
EUR 408

GAPDH(HRP conjugated) Antibody

49380-100ul 100ul
EUR 333

GAPDH(HRP conjugated) Antibody

49380-50ul 50ul
EUR 239

GFP(HRP conjugated) Antibody

49383-100ul 100ul
EUR 333

GFP(HRP conjugated) Antibody

49383-50ul 50ul
EUR 239

TMEM237 Antibody, HRP conjugated

1-CSB-PA822287OB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TMEM237. Recognizes TMEM237 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSKH2 Antibody, HRP conjugated

1-CSB-PA822291LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSKH2. Recognizes PSKH2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PASK Antibody, HRP conjugated

1-CSB-PA822296LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PASK. Recognizes PASK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UCN2 Antibody, HRP conjugated

1-CSB-PA822298LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UCN2. Recognizes UCN2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CAMKK2 Antibody, HRP conjugated

1-CSB-PA822299LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CAMKK2. Recognizes CAMKK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CXCL10 Antibody, HRP conjugated

1-CSB-PA822646LB01MOW
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXCL10. Recognizes CXCL10 from Macaca mulatta. This antibody is HRP conjugated. Tested in the following application: ELISA

LGI2 Antibody, HRP conjugated

1-CSB-PA822674LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGI2. Recognizes LGI2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TTC5 Antibody, HRP conjugated

1-CSB-PA822676LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TTC5. Recognizes TTC5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LSMEM2 Antibody, HRP conjugated

1-CSB-PA822677LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LSMEM2. Recognizes LSMEM2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CPXCR1 Antibody, HRP conjugated

1-CSB-PA822678LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CPXCR1. Recognizes CPXCR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

C4orf33 Antibody, HRP conjugated

1-CSB-PA822682LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against C4orf33. Recognizes C4orf33 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NUP93 Antibody, HRP conjugated

1-CSB-PA822683LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BATF2 Antibody, HRP conjugated

1-CSB-PA822685LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BATF2. Recognizes BATF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

C20orf197 Antibody, HRP conjugated

1-CSB-PA822688DB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against C20orf197. Recognizes C20orf197 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

OSR2 Antibody, HRP conjugated

1-CSB-PA822691LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OSR2. Recognizes OSR2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PIAS4 Antibody, HRP conjugated

1-CSB-PA822692LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIAS4. Recognizes PIAS4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MUC20 Antibody, HRP conjugated

1-CSB-PA822693LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MUC20. Recognizes MUC20 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

OR2L13 Antibody, HRP conjugated

1-CSB-PA822694LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OR2L13. Recognizes OR2L13 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PPM1K Antibody, HRP conjugated

1-CSB-PA822697LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PPM1K. Recognizes PPM1K from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GALNT15 Antibody, HRP conjugated

1-CSB-PA822698LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALNT15. Recognizes GALNT15 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LIX1 Antibody, HRP conjugated

1-CSB-PA822702LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

STX19 Antibody, HRP conjugated

1-CSB-PA822703LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STX19. Recognizes STX19 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SPEM1 Antibody, HRP conjugated

1-CSB-PA822704LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPEM1. Recognizes SPEM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

WDTC1 Antibody, HRP conjugated

1-CSB-PA822706LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WDTC1. Recognizes WDTC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FAM160A2 Antibody, HRP conjugated

1-CSB-PA822711LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FAM160A2. Recognizes FAM160A2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RNF182 Antibody, HRP conjugated

1-CSB-PA822714LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF182. Recognizes RNF182 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IL22RA1 Antibody, HRP conjugated

1-CSB-PA822717LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IL22RA1. Recognizes IL22RA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PCDH20 Antibody, HRP conjugated

1-CSB-PA822719LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCDH20. Recognizes PCDH20 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EFHB Antibody, HRP conjugated

1-CSB-PA822723LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EFHB. Recognizes EFHB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

C2orf69 Antibody, HRP conjugated

1-CSB-PA822731LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against C2orf69. Recognizes C2orf69 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

C9orf163 Antibody, HRP conjugated

1-CSB-PA822739LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against C9orf163. Recognizes C9orf163 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TRIML1 Antibody, HRP conjugated

1-CSB-PA822741LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIML1. Recognizes TRIML1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TERB1 Antibody, HRP conjugated

1-CSB-PA822742LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TERB1. Recognizes TERB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

C12orf50 Antibody, HRP conjugated

1-CSB-PA822743LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against C12orf50. Recognizes C12orf50 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CASTOR3 Antibody, HRP conjugated

1-CSB-PA822746LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CASTOR3. Recognizes CASTOR3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KDM1B Antibody, HRP conjugated

1-CSB-PA822748LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KDM1B. Recognizes KDM1B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KLHL23 Antibody, HRP conjugated

1-CSB-PA822749LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KLHL23. Recognizes KLHL23 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UXS1 Antibody, HRP conjugated

1-CSB-PA822754LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UXS1. Recognizes UXS1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KCTD6 Antibody, HRP conjugated

1-CSB-PA822756LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCTD6. Recognizes KCTD6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SIMC1 Antibody, HRP conjugated

1-CSB-PA822768LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SIMC1. Recognizes SIMC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NSUN7 Antibody, HRP conjugated

1-CSB-PA822769LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NSUN7. Recognizes NSUN7 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TRPV1 Antibody, HRP conjugated

1-CSB-PA822774LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRPV1. Recognizes TRPV1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

WFDC9 Antibody, HRP conjugated

1-CSB-PA822776LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WFDC9. Recognizes WFDC9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ATP6V1C2 Antibody, HRP conjugated

1-CSB-PA822777LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP6V1C2. Recognizes ATP6V1C2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DBF4B Antibody, HRP conjugated

1-CSB-PA822784LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DBF4B. Recognizes DBF4B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CDC26 Antibody, HRP conjugated

1-CSB-PA822822LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CDC26. Recognizes CDC26 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

Leave a Reply

Your email address will not be published. Required fields are marked *