December 4, 2020
lembcke.dk

Comparability of Affected person-collected and Lab Technician-collected Nasopharyngeal and Oropharyngeal Swabs

Comparability of Affected person-collected and Lab Technician-collected Nasopharyngeal and Oropharyngeal Swabs for Detection of COVID-19 by RT-PCR

Background & goal: A easy strategy to stop shut contact in healthcare settings throughout the COVID-19 outbreak is to coach sufferers to gather their very own nasopharyngeal and oropharyngeal swabs and ship them to medical laboratories to have them processed.
The goal of our examine was to check lab technician- with patient- collected oropharyngeal and nasopharyngeal samples for detection of the coronavirus illness 2019 (COVID 19) utilizing fast real-time polymerase chain response (rRT-PCR).

Strategies: 
Fifty grownup sufferers with flu-like signs and radiologic findings suitable with atypical pneumonia who have been admitted to the infectious illnesses ward of Imam Khomeini Hospital Complicated, Tehran, Iran, with a medical analysis of COVID-19 from February 28 to April 27 of 2020 have been randomly chosen and entered in our examine.
Two units of naso- and oropharyngeal swabs have been collected, one set by a lab technician and the opposite by the sufferers, and the COVID-19 rRT-PCR take a look at was carried out.
Outcomes: Of 50 chosen circumstances, in seven sufferers all collected naso- and oropharyngeal swabs examined constructive, and in 22 sufferers all samples examined adverse for COVID-19 in rRT-PCR. Discrepancies between rRT-PCR outcomes of lab technician- and patient-collected swabs have been noticed in 12 nasopharyngeal and 13 oropharyngeal specimens.
Constructive lab technician-collected and adverse patient-collected samples have been noticed in 10 and 5 nasopharyngeal and oropharyngeal specimens, respectively.
Adverse lab technician-collected and constructive patient-collected samples have been noticed in two and 7 nasopharyngeal and oropharyngeal specimens, respectively. The general share of settlement amongst each nasopharyngeal and oropharyngeal swabs taken by a lab technician and sufferers was 76% with a kappa worth of 0.49 (P=0.001).
Conclusion: Primarily based on our findings, lab technician-collected naso- and oropharyngeal swabs can’t be changed by patient-collected ones with regard to COVID-19 rRT-PCR.

lembcke.dk

Mouse Interleukin 17B (IL17B) ELISA Kit

DLR-IL17B-Mu-48T 48T
EUR 454
  • Should the Mouse Interleukin 17B (IL17B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Interleukin 17B (IL17B) in samples from serum, plasma or other biological fluids.

Mouse Interleukin 17B (IL17B) ELISA Kit

DLR-IL17B-Mu-96T 96T
EUR 587
  • Should the Mouse Interleukin 17B (IL17B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Interleukin 17B (IL17B) in samples from serum, plasma or other biological fluids.

Rat Interleukin 17B (IL17B) ELISA Kit

DLR-IL17B-Ra-48T 48T
EUR 475
  • Should the Rat Interleukin 17B (IL17B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Interleukin 17B (IL17B) in samples from serum, plasma or other biological fluids.

Rat Interleukin 17B (IL17B) ELISA Kit

DLR-IL17B-Ra-96T 96T
EUR 616
  • Should the Rat Interleukin 17B (IL17B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Interleukin 17B (IL17B) in samples from serum, plasma or other biological fluids.

Human Interleukin 17B (IL17B) ELISA Kit

RD-IL17B-Hu-48Tests 48 Tests
EUR 439

Human Interleukin 17B (IL17B) ELISA Kit

RD-IL17B-Hu-96Tests 96 Tests
EUR 606

Mouse Interleukin 17B (IL17B) ELISA Kit

RD-IL17B-Mu-48Tests 48 Tests
EUR 450

Mouse Interleukin 17B (IL17B) ELISA Kit

RD-IL17B-Mu-96Tests 96 Tests
EUR 622

Rat Interleukin 17B (IL17B) ELISA Kit

RD-IL17B-Ra-48Tests 48 Tests
EUR 473

Rat Interleukin 17B (IL17B) ELISA Kit

RD-IL17B-Ra-96Tests 96 Tests
EUR 655

Human Interleukin 17B (IL17B) ELISA Kit

RDR-IL17B-Hu-48Tests 48 Tests
EUR 458

Human Interleukin 17B (IL17B) ELISA Kit

RDR-IL17B-Hu-96Tests 96 Tests
EUR 633

Mouse Interleukin 17B (IL17B) ELISA Kit

RDR-IL17B-Mu-48Tests 48 Tests
EUR 470

Mouse Interleukin 17B (IL17B) ELISA Kit

RDR-IL17B-Mu-96Tests 96 Tests
EUR 651

Rat Interleukin 17B (IL17B) ELISA Kit

RDR-IL17B-Ra-48Tests 48 Tests
EUR 495

Rat Interleukin 17B (IL17B) ELISA Kit

RDR-IL17B-Ra-96Tests 96 Tests
EUR 685

IL17B Protein

20-abx260754
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

IL17B Protein

20-abx260760
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

IL17B protein

30R-AI110 25 ug
EUR 273
Description: Purified recombinant Human IL17B protein

IL17B Antibody

ABD8979 100 ug
EUR 438

IL17B siRNA

20-abx920420
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IL17B siRNA

20-abx920421
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IL17B antibody

70R-IR035 50 ug
EUR 273
Description: Affinity purified Rabbit polyclonal IL17B antibody

IL17B Antibody

45629-100ul 100ul
EUR 252

IL17B Antibody

45629-50ul 50ul
EUR 187

IL17B Antibody

DF8979 200ul
EUR 304
Description: IL17B Antibody detects endogenous levels of total IL17B.

IL17B Antibody

1-CSB-PA648539
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against IL17B. Recognizes IL17B from Human, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000

anti-IL17B

YF-PA18411 100 ug
EUR 403
Description: Rabbit polyclonal to IL17B

anti-IL17B

YF-PA26051 50 ul
EUR 334
Description: Mouse polyclonal to IL17B

IL17B protein (His tag)

80R-2782 100 ug
EUR 322
Description: Purified recombinant IL17B protein (His tag)

IL17B Conjugated Antibody

C45629 100ul
EUR 397

Anti-IL17B Antibody

A10846-2 100ug/vial
EUR 294

Anti-IL17B Antibody

A10846-3 100ug/vial
EUR 294

IL17B Blocking Peptide

DF8979-BP 1mg
EUR 195

IL17B cloning plasmid

CSB-CL890693HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 543
  • Sequence: ATGGACTGGCCTCACAACCTGCTGTTTCTTCTTACCATTTCCATCTTCCTGGGGCTGGGCCAGCCCAGGAGCCCCAAAAGCAAGAGGAAGGGGCAAGGGCGGCCTGGGCCCCTGGCCCCTGGCCCTCACCAGGTGCCACTGGACCTGGTGTCACGGATGAAACCGTATGCCCGCAT
  • Show more
Description: A cloning plasmid for the IL17B gene.

Anti-IL17B antibody

PAab04226 100 ug
EUR 412

Anti-IL17B (6G5)

YF-MA18183 100 ug
EUR 363
Description: Mouse monoclonal to IL17B

Anti-IL17B (1G6)

YF-MA18184 100 ug
EUR 363
Description: Mouse monoclonal to IL17B

anti-IL17B Receptor

YF-PA26340 50 ul
EUR 334
Description: Mouse polyclonal to IL17B Receptor

Mouse Interleukin 17B (IL17B) Protein

20-abx653985
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Interleukin 17B (IL17B) Protein

20-abx653986
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Interleukin 17B (IL17B) Protein

20-abx067473
  • EUR 704.00
  • EUR 286.00
  • EUR 2193.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Interleukin 17B (IL17B) Protein

20-abx067475
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Interleukin 17B (IL17B) Protein (Active)

20-abx651382
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Active Interleukin 17B (IL17B)

4-APB700Hu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UHF5
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.1kDa
  • Isoelectric Point: 9.7
Description: Recombinant Human Interleukin 17B expressed in: E.coli

Polyclonal IL17B Antibody (Center)

APR03644G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IL17B (Center). This antibody is tested and proven to work in the following applications:

Mouse IL17B shRNA Plasmid

20-abx974610
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human IL17B ELISA Kit

ELA-E2103h 96 Tests
EUR 824

IL17B ELISA KIT|Human

EF006182 96 Tests
EUR 689

Interleukin 17B (IL17B) Antibody

20-abx101512
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interleukin 17B (IL17B) Antibody

20-abx101513
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interleukin 17B (IL17B) Antibody

abx038115-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Interleukin 17B (IL17B) Antibody

20-abx173104
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Interleukin 17B (IL17B) Antibody

20-abx173105
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Interleukin 17B (IL17B) Antibody

20-abx177117
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Interleukin 17B (IL17B) Antibody

20-abx177118
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Interleukin 17B (IL17B) Antibody

20-abx216191
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interleukin 17B (IL17B) Antibody

20-abx330118
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interleukin 17B (IL17B) Antibody

abx234226-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human IL17B shRNA Plasmid

20-abx959017
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Interleukin 17B (IL17B)

4-RPB700Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UHF5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.0kDa
  • Isoelectric Point: 9.7
Description: Recombinant Human Interleukin 17B expressed in: E.coli

Recombinant Interleukin 17B (IL17B)

4-RPB700Ra01
  • EUR 508.58
  • EUR 239.00
  • EUR 1632.16
  • EUR 610.72
  • EUR 1121.44
  • EUR 403.00
  • EUR 3930.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: G3V8K9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.4kDa
  • Isoelectric Point: 9.5
Description: Recombinant Rat Interleukin 17B expressed in: E.coli

IL17B Protein Vector (Human) (pPB-C-His)

PV053357 500 ng
EUR 481

IL17B Protein Vector (Human) (pPB-N-His)

PV053358 500 ng
EUR 481

IL17B Protein Vector (Human) (pPM-C-HA)

PV053359 500 ng
EUR 481

IL17B Protein Vector (Human) (pPM-C-His)

PV053360 500 ng
EUR 481

IL17B Protein Vector (Rat) (pPB-C-His)

PV274366 500 ng
EUR 603

IL17B Protein Vector (Rat) (pPB-N-His)

PV274367 500 ng
EUR 603

IL17B Protein Vector (Rat) (pPM-C-HA)

PV274368 500 ng
EUR 603

IL17B Protein Vector (Rat) (pPM-C-His)

PV274369 500 ng
EUR 603

IL17B Protein Vector (Mouse) (pPB-C-His)

PV191262 500 ng
EUR 603

IL17B Protein Vector (Mouse) (pPB-N-His)

PV191263 500 ng
EUR 603

IL17B Protein Vector (Mouse) (pPM-C-HA)

PV191264 500 ng
EUR 603

IL17B Protein Vector (Mouse) (pPM-C-His)

PV191265 500 ng
EUR 603

Human Interleukin17B (IL17B) ELISA Kit

CSB-E15918h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Interleukin17B (IL17B) in samples from serum, plasma, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin17B (IL17B) ELISA Kit

1-CSB-E15918h
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Interleukin17B (IL17B) in samples from serum, plasma, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Il17b ORF Vector (Rat) (pORF)

ORF068592 1.0 ug DNA
EUR 506

Il17b ORF Vector (Mouse) (pORF)

ORF047816 1.0 ug DNA
EUR 506

IL17B ORF Vector (Human) (pORF)

ORF013340 1.0 ug DNA
EUR 354

IL17B Human, Interleukin-17B Human Recombinant Protein, Sf9

PROTQ9UHF5-2 Regular: 5ug
EUR 317
Description: IL17B Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 169 amino acids (21-180a.a.) and having a molecular mass of 19.2kDa (Molecular size on SDS-PAGE will appear at approximately 18-28kDa). IL17B is expressed with a 6 amino acid His-tag at C-Terminus and purified by proprietary chromatographic techniques.

Human Interleukin 17B (IL17B) ELISA Kit

abx574703-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Interleukin 17B (IL17B) ELISA Kit

abx574963-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Il17b/ Interleukin-17B ELISA Kit

E0754Mo 1 Kit
EUR 546

Human IL17B/ Interleukin-17B ELISA Kit

E1264Hu 1 Kit
EUR 571

Human IL17B(Interleukin-17B) ELISA Kit

EH2104 96T
EUR 567.6
  • Detection range: 15.6-1000 pg/ml
  • Uniprot ID: Q9UHF5
  • Alias: IL17B/Cytokine Zcyto7/cytokine-like protein ZCYTO7/IL-17Binterleukin-17 beta/IL20/IL-20interleukin-17B/interleukin 17B/interleukin 20/Interleukin-20/MGC138900/MGC138901/neuronal interleukin-1
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Interleukin- 17B, IL17B ELISA KIT

ELI-06753h 96 Tests
EUR 824

Mouse Interleukin- 17B, Il17b ELISA KIT

ELI-06754m 96 Tests
EUR 865

Rat Interleukin 17B (IL17B) ELISA Kit

20-abx155721
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Interleukin 17B (IL17B) ELISA Kit

20-abx154238
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Interleukin 17B (IL17B) ELISA Kit

20-abx152021
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Interleukin 17B (IL17B) CLIA Kit

20-abx190244
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Interleukin 17B (IL17B) CLIA Kit

20-abx190529
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Interleukin 17B (IL17B) CLIA Kit

20-abx190699
  • EUR 8443.00
  • EUR 4497.00
  • EUR 1036.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Il17b sgRNA CRISPR Lentivector set (Mouse)

K3695201 3 x 1.0 ug
EUR 339

Mouse Interleukin-17B(IL17B) ELISA kit

CSB-EL011598MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin-17B (IL17B) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Interleukin-17B(IL17B) ELISA kit

1-CSB-EL011598MO
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin-17B(IL17B) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

IL17B sgRNA CRISPR Lentivector set (Human)

K1079901 3 x 1.0 ug
EUR 339

Interleukin 17B (IL17B) Polyclonal Antibody (Human)

4-PAB700Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL17B (Gln21~Phe180)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interleukin 17B (IL17B)

Interleukin 17B (IL17B) Polyclonal Antibody (Rat)

4-PAB700Ra01
  • EUR 251.00
  • EUR 2589.00
  • EUR 643.00
  • EUR 317.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IL17B (Arg23~Phe180)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interleukin 17B (IL17B)

Il17b sgRNA CRISPR Lentivector set (Rat)

K6953501 3 x 1.0 ug
EUR 339

Human Interleukin 17B (IL17B) ELISA Kit

SEB700Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Human Interleukin 17B (IL17B) ELISA Kit

SEB700Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Human Interleukin 17B (IL17B) ELISA Kit

SEB700Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Human Interleukin 17B (IL17B) ELISA Kit

SEB700Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Human Interleukin 17B (IL17B) ELISA Kit

4-SEB700Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 17B elisa. Alternative names of the recognized antigen: IL-20
  • Cytokine Zcyto7
  • Neuronal interleukin-17-related factor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Interleukin 17B (IL17B) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Interleukin 17B (IL17B) ELISA Kit

SEB700Mu-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Mouse Interleukin 17B (IL17B) ELISA Kit

SEB700Mu-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Mouse Interleukin 17B (IL17B) ELISA Kit

SEB700Mu-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Mouse Interleukin 17B (IL17B) ELISA Kit

SEB700Mu-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Mouse Interleukin 17B (IL17B) ELISA Kit

4-SEB700Mu
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 17B elisa. Alternative names of the recognized antigen: IL-20
  • Cytokine Zcyto7
  • Neuronal interleukin-17-related factor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Interleukin 17B (IL17B) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Interleukin 17B (IL17B) ELISA Kit

SEB700Ra-10x96wellstestplate 10x96-wells test plate
EUR 4875.49
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Rat Interleukin 17B (IL17B) ELISA Kit

SEB700Ra-1x48wellstestplate 1x48-wells test plate
EUR 489.16
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Rat Interleukin 17B (IL17B) ELISA Kit

SEB700Ra-1x96wellstestplate 1x96-wells test plate
EUR 655.94
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Rat Interleukin 17B (IL17B) ELISA Kit

SEB700Ra-5x96wellstestplate 5x96-wells test plate
EUR 2651.73
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Rat Interleukin 17B (IL17B) ELISA Kit

4-SEB700Ra
  • EUR 4926.00
  • EUR 2602.00
  • EUR 656.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Interleukin 17B elisa. Alternative names of the recognized antigen: IL-20
  • Cytokine Zcyto7
  • Neuronal interleukin-17-related factor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Interleukin 17B (IL17B) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Interleukin 17B (IL17B)CLIA Kit

SCB700Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Human Interleukin 17B (IL17B)CLIA Kit

SCB700Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Human Interleukin 17B (IL17B)CLIA Kit

SCB700Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Human Interleukin 17B (IL17B)CLIA Kit

SCB700Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 17B (IL17B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Interleukin 17B (IL17B) in serum, plasma and other biological fluids.

Enriched excessive‑throughput reverse transcription‑quantitative PCR template preparation with out pre‑amplification

A cDNA template with a excessive focus is required to generate a excessive variety of copies for correct downstream excessive‑throughput reverse transcription‑quantitative PCR screening. Nonetheless, with the normal methodology, pre‑amplification is just not broadly out there.
Within the current examine, a novel technique to resolve the pre‑amplification limitation has been developed. Whole RNA was extracted utilizing a commercially out there RNeasy Micro equipment then, the cDNA was synthesized utilizing SuperScript® III First‑Strand Synthesis system. PCR inhibitors (proteins and soluble salt ions) within the enriched cDNA have been eliminated utilizing saturated phenol‑chloroform extraction.
Lastly, genes have been evaluated utilizing PCR amplification and the BioMark™ HD system. The constructive detection fee of particular person goal gene expression reached 70.18%; nonetheless, it markedly decreased to 35.42% utilizing PCR amplification with out prior dilution.
Subsequent, the reverse transcription product was purified utilizing saturated phenol‑chloroform extraction, and the constructive detection fee elevated to 97.04%. Notably, the constructive detection fee of cDNA ready utilizing this methodology of excessive‑throughput and conventional PCR (97.04 vs. 96.6%) was not considerably completely different. In conclusion, the outcomes reveal the novel methodology was a simple and reproducible methodology for performing strong and extremely correct focused amplification.

A Novel Actual-time PCR-based Screening Check with Pooled Faecal Samples for Bovine Johne’s Illness

Johne’s illness (JD) is an economically essential infectious illness in livestock farming brought on by <i>Mycobacterium avium</i> subsp. <i>paratuberculosis</i> (MAP). As a substitute for serological exams, that are primarily used for the screening of entire herds, we developed a novel ResoLight-based real-time PCR (RL-PCR) assay with pooled faecal samples for the detection of faecal shedders in cattle herds.
The RL-PCR assay included an inside amplification management (IC) which was amplified utilizing the identical primer pair because the goal molecule MAP IS<i>900</i> and differentiated primarily based on melting temperatures. Particular person faecal suspensions have been pooled and concentrated by centrifugation to keep away from lack of sensitivity by dilution impact. Mixed with a DNA extraction equipment (Johne-PureSpin, FASMAC), no inhibition of PCR amplification was noticed with as much as 15 faecal samples in a pool.
The detection restrict of RL-PCR at a pool dimension of 10 was 10 MAP organisms per gram of faeces, which was corresponding to particular person testing. A complete of two,654 animals in 12 contaminated herds have been screened by particular person antibody-ELISA and the RL-PCR assay utilizing pooled faeces. Fifty animals have been identified with JD by the screening by RL-PCR, in comparison with solely 5 by ELISA (which have been additionally constructive in RL-PCR).
In 7 JD free herds, the outcomes of four out of 327 swimming pools (1.2%) have been invalid as a result of lack of IC amplification, after which animals have been confirmed adverse individually. Our outcomes recommend that implementation of herd screening by pooled RL-PCR would advance the monitoring and management of JD in cattle herds.
Product not found

Leave a Reply

Your email address will not be published. Required fields are marked *