October 21, 2021

CD36 Lentiviral Vector (human)

CD36 Lentiviral Vector (human) 

To Order Contact us: bjorn@lembcke.dk


36F2-100T 100 test
EUR 484.2


36PE-100T 100 test
EUR 466


36PP5.52-100T 100 test
EUR 492


36PU2-01MG 100 test
EUR 375


PR27320 5 ug
EUR 318


RA25035 100 ul
EUR 422

CD36 ORF Vector (Human) (pORF)

ORF002116 1.0 ug DNA
EUR 95

Cd36/ Rat Cd36 ELISA Kit

ELI-02353r 96 Tests
EUR 886

CD36 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV675289 1.0 ug DNA
EUR 682

CD36 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV675293 1.0 ug DNA
EUR 682

CD36 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV675294 1.0 ug DNA
EUR 682

CD36 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD36 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD36 protein

80R-4357 20 ug
EUR 349
Description: Purified Recombinant CD36 protein (His tagged)

CD36 antibody

70R-6098 50 ug
EUR 467
Description: Rabbit polyclonal CD36 antibody

CD36 antibody

70R-6104 50 ug
EUR 467
Description: Rabbit polyclonal CD36 antibody

CD36 Antibody

49232-100ul 100ul
EUR 333

CD36 Antibody

49232-50ul 50ul
EUR 239

CD36 antibody

10-2582 100 ug
EUR 241
Description: Mouse monoclonal CD36 antibody

CD36 antibody

10R-6387 100 ug
EUR 208
Description: Rat monoclonal CD36 antibody

CD36 antibody

10R-6388 100 ug
EUR 273
Description: Mouse monoclonal CD36 antibody

CD36 antibody

10R-CD36aHU 200 tests
EUR 419
Description: Mouse monoclonal CD36 antibody

CD36 Antibody

33046-100ul 100ul
EUR 252

CD36 antibody

10R-3612 100 ul
EUR 691
Description: Mouse monoclonal CD36 antibody

CD36 antibody

70R-16271 50 ul
EUR 435
Description: Rabbit polyclonal CD36 antibody

CD36 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CD36. Recognizes CD36 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

CD36 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CD36. Recognizes CD36 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

CD36 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD36. Recognizes CD36 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CD36 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD36. Recognizes CD36 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

CD36 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD36. Recognizes CD36 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Human CD36 ELISA Kit

ELA-E0674h 96 Tests
EUR 824

Human CD36 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CD36 Recombinant Protein (Human)

RP006346 100 ug Ask for price

Human CellExp? CD36, human recombinant

EUR 245

Human CellExp? CD36, human recombinant

EUR 697

Cd36 ORF Vector (Mouse) (pORF)

ORF040854 1.0 ug DNA
EUR 506

Cd36 ORF Vector (Mouse) (pORF)

ORF040855 1.0 ug DNA
EUR 506

Cd36 ORF Vector (Mouse) (pORF)

ORF040856 1.0 ug DNA
EUR 506

Cd36 ORF Vector (Mouse) (pORF)

ORF040857 1.0 ug DNA
EUR 506

Cd36 ORF Vector (Mouse) (pORF)

ORF040858 1.0 ug DNA
EUR 506

Cd36 ORF Vector (Rat) (pORF)

ORF064649 1.0 ug DNA
EUR 506

CD36 Protein Vector (Human) (pPB-C-His)

PV008461 500 ng
EUR 329

CD36 Protein Vector (Human) (pPB-N-His)

PV008462 500 ng
EUR 329

CD36 Protein Vector (Human) (pPM-C-HA)

PV008463 500 ng
EUR 329

CD36 Protein Vector (Human) (pPM-C-His)

PV008464 500 ng
EUR 329

CD36 Conjugated Antibody

C49232 100ul
EUR 397

CD36(1E8.) Antibody

BNC610314-100 100uL
EUR 199
Description: Primary antibody against CD36(1E8.), CF660R conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC610314-500 500uL
EUR 544
Description: Primary antibody against CD36(1E8.), CF660R conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC680314-100 100uL
EUR 199
Description: Primary antibody against CD36(1E8.), CF568 conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC680314-500 500uL
EUR 544
Description: Primary antibody against CD36(1E8.), CF568 conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC430314-100 100uL
EUR 199
Description: Primary antibody against CD36(1E8.), CF543 conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC430314-500 500uL
EUR 544
Description: Primary antibody against CD36(1E8.), CF543 conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC550314-100 100uL
EUR 199
Description: Primary antibody against CD36(1E8.), CF555 conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC550314-500 500uL
EUR 544
Description: Primary antibody against CD36(1E8.), CF555 conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC040314-100 100uL
EUR 199
Description: Primary antibody against CD36(1E8.), CF405S conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC040314-500 500uL
EUR 544
Description: Primary antibody against CD36(1E8.), CF405S conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC050314-100 100uL
EUR 199
Description: Primary antibody against CD36(1E8.), CF405M conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC050314-500 500uL
EUR 544
Description: Primary antibody against CD36(1E8.), CF405M conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC400314-100 100uL
EUR 199
Description: Primary antibody against CD36(1E8.), CF640R conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC400314-500 500uL
EUR 544
Description: Primary antibody against CD36(1E8.), CF640R conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC470314-100 100uL
EUR 199
Description: Primary antibody against CD36(1E8.), CF647 conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC470314-500 500uL
EUR 544
Description: Primary antibody against CD36(1E8.), CF647 conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNUM0314-50 50uL
EUR 395
Description: Primary antibody against CD36(1E8.), 1mg/mL

CD36(1E8.) Antibody

BNC700314-100 100uL
EUR 199
Description: Primary antibody against CD36(1E8.), CF770 conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC700314-500 500uL
EUR 544
Description: Primary antibody against CD36(1E8.), CF770 conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC940314-100 100uL
EUR 199
Description: Primary antibody against CD36(1E8.), CF594 conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC940314-500 500uL
EUR 544
Description: Primary antibody against CD36(1E8.), CF594 conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNCH0314-100 100uL
EUR 199
Description: Primary antibody against CD36(1E8.), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNCH0314-500 500uL
EUR 544
Description: Primary antibody against CD36(1E8.), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC800314-100 100uL
EUR 199
Description: Primary antibody against CD36(1E8.), CF680 conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC800314-500 500uL
EUR 544
Description: Primary antibody against CD36(1E8.), CF680 conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC810314-100 100uL
EUR 199
Description: Primary antibody against CD36(1E8.), CF680R conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC810314-500 500uL
EUR 544
Description: Primary antibody against CD36(1E8.), CF680R conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNCP0314-250 250uL
EUR 383
Description: Primary antibody against CD36(1E8.), PerCP conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNCR0314-250 250uL
EUR 383
Description: Primary antibody against CD36(1E8.), RPE conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNCA0314-250 250uL
EUR 383
Description: Primary antibody against CD36(1E8.), APC conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNCAP0314-100 100uL
EUR 199
Description: Primary antibody against CD36(1E8.), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNCAP0314-500 500uL
EUR 544
Description: Primary antibody against CD36(1E8.), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNCB0314-100 100uL
EUR 199
Description: Primary antibody against CD36(1E8.), Biotin conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNCB0314-500 500uL
EUR 544
Description: Primary antibody against CD36(1E8.), Biotin conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC880314-100 100uL
EUR 199
Description: Primary antibody against CD36(1E8.), CF488A conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNC880314-500 500uL
EUR 544
Description: Primary antibody against CD36(1E8.), CF488A conjugate, Concentration: 0.1mg/mL

CD36(1E8.) Antibody

BNUB0314-100 100uL
EUR 209
Description: Primary antibody against CD36(1E8.), Concentration: 0.2mg/mL

CD36(1E8.) Antibody

BNUB0314-500 500uL
EUR 458
Description: Primary antibody against CD36(1E8.), Concentration: 0.2mg/mL

CD36 cloning plasmid

CSB-CL004927HU-10ug 10ug
EUR 507
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1419
  • Sequence: atgggctgtgaccggaactgtgggctcatcgctggggctgtcattggtgctgtcctggctgtgtttggaggtattctaatgccagttggagacctgcttatccagaagacaattaaaaagcaagttgtcctcgaagaaggtacaattgcttttaaaaattgggttaaaacaggca
  • Show more
Description: A cloning plasmid for the CD36 gene.

anti- CD36 antibody

FNab01470 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: CD36 molecule(thrombospondin receptor)
  • Uniprot ID: P16671
  • Gene ID: 948
  • Research Area: Stem Cells, Immunology, Cardiovascular
Description: Antibody raised against CD36

CD36 Polyclonal Antibody

ES4315-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD36 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CD36 Polyclonal Antibody

ES4315-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD36 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CD36 Polyclonal Antibody

ABP53316-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD36
  • Applications tips:
Description: A polyclonal antibody for detection of CD36 from Human, Mouse, Rat. This CD36 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD36

CD36 Polyclonal Antibody

ABP53316-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD36
  • Applications tips:
Description: A polyclonal antibody for detection of CD36 from Human, Mouse, Rat. This CD36 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD36

CD36 Polyclonal Antibody

ABP53316-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD36
  • Applications tips:
Description: A polyclonal antibody for detection of CD36 from Human, Mouse, Rat. This CD36 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD36

CD36 Rabbit pAb

A5792-100ul 100 ul
EUR 308

CD36 Rabbit pAb

A5792-200ul 200 ul
EUR 459

CD36 Rabbit pAb

A5792-20ul 20 ul
EUR 183

CD36 Rabbit pAb

A5792-50ul 50 ul
EUR 223

CD36 Rabbit pAb

A17339-100ul 100 ul
EUR 308

CD36 Rabbit pAb

A17339-200ul 200 ul
EUR 459

CD36 Rabbit pAb

A17339-20ul 20 ul
EUR 183

CD36 Rabbit pAb

A17339-50ul 50 ul
EUR 223

CD36 Rabbit pAb

A17340-100ul 100 ul
EUR 308

CD36 Rabbit pAb

A17340-200ul 200 ul
EUR 459

CD36 Rabbit pAb

A17340-20ul 20 ul
EUR 183

CD36 Rabbit pAb

A17340-50ul 50 ul
EUR 223

CD36 Rabbit mAb

A19016-100ul 100 ul
EUR 410

CD36 Rabbit mAb

A19016-200ul 200 ul
EUR 571

CD36 Rabbit mAb

A19016-20ul 20 ul
EUR 221

CD36 Rabbit mAb

A19016-50ul 50 ul
EUR 287

CD36 Rabbit pAb

A1470-100ul 100 ul
EUR 308

CD36 Rabbit pAb

A1470-200ul 200 ul
EUR 459

CD36 Rabbit pAb

A1470-20ul 20 ul
EUR 183

CD36 Rabbit pAb

A1470-50ul 50 ul
EUR 223

CD36 Rabbit pAb

A14714-100ul 100 ul
EUR 308

CD36 Rabbit pAb

A14714-200ul 200 ul
EUR 459

CD36 Rabbit pAb

A14714-20ul 20 ul
EUR 183

CD36 Rabbit pAb

A14714-50ul 50 ul
EUR 223

CD36 Blocking Peptide

33R-4679 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CD36 antibody, catalog no. 70R-6098

CD36 Blocking Peptide

33R-6013 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CD36 antibody, catalog no. 70R-6104

CD36 antibody (PE)

61R-1239 100 ug
EUR 354
Description: Rat monoclonal CD36 antibody (PE)

CD36 antibody (FITC)

61R-CD36aHU 100 tests
EUR 476
Description: Mouse monoclonal CD36 antibody (FITC)

Anti-CD36 Antibody

PB9371 100ug/vial
EUR 334

Anti-CD36 antibody

PAab01470 100 ug
EUR 386


PVT18169 2 ug
EUR 231

Anti-CD36 antibody

STJ97280 200 µl
EUR 197
Description: Rabbit polyclonal to CD36.

Anti-CD36 antibody

STJ28356 100 µl
EUR 277
Description: The protein encoded by this gene is the fourth major glycoprotein of the platelet surface and serves as a receptor for thrombospondin in platelets and various cell lines. Since thrombospondins are widely distributed proteins involved in a variety of adhesive processes, this protein may have important functions as a cell adhesion molecule. It binds to collagen, thrombospondin, anionic phospholipids and oxidized LDL. It directly mediates cytoadherence of Plasmodium falciparum parasitized erythrocytes and it binds long chain fatty acids and may function in the transport and/or as a regulator of fatty acid transport. Mutations in this gene cause platelet glycoprotein deficiency. Multiple alternatively spliced transcript variants have been found for this gene.

Anti-CD36 Antibody

STJ500463 100 µg
EUR 476

Anti-CD36 antibody

STJ22993 100 µl
EUR 277
Description: The protein encoded by this gene is the fourth major glycoprotein of the platelet surface and serves as a receptor for thrombospondin in platelets and various cell lines. Since thrombospondins are widely distributed proteins involved in a variety of adhesive processes, this protein may have important functions as a cell adhesion molecule. It binds to collagen, thrombospondin, anionic phospholipids and oxidized LDL. It directly mediates cytoadherence of Plasmodium falciparum parasitized erythrocytes and it binds long chain fatty acids and may function in the transport and/or as a regulator of fatty acid transport. Mutations in this gene cause platelet glycoprotein deficiency. Multiple alternatively spliced transcript variants have been found for this gene.

CD36 Lentiviral Vector (human)