May 14, 2021

BRD2-HA Lentiviral Vector Human

BRD2-HA Lentiviral Vector Human 

To Order Contact us:

BRD2-IT1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV719826 1.0 ug DNA Ask for price

BRD2 ORF Vector (Human) (pORF)

ORF001061 1.0 ug DNA
EUR 95

BRD2 Protein Vector (Human) (pPM-N-D-C-HA)

PV327460 500 ng
EUR 329

BRD2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV674396 1.0 ug DNA
EUR 1355

BRD2-IT1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV719825 1.0 ug DNA Ask for price

BRD2-IT1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV719829 1.0 ug DNA Ask for price

BRD2-IT1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV719830 1.0 ug DNA Ask for price


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BRD2 Antibody

49970-100ul 100ul
EUR 333

BRD2 Antibody

49970-50ul 50ul
EUR 239

BRD2 Antibody

EUR 349

BRD2 Antibody

EUR 146

BRD2 Antibody

DF12857 200ul
EUR 304
Description: BRD2 Antibody detects endogenous levels of BRD2.


YF-PA14402 50 ug
EUR 363
Description: Mouse polyclonal to BRD2


YF-PA14403 100 ul
EUR 403
Description: Rabbit polyclonal to BRD2


YF-PA24585 50 ul
EUR 334
Description: Mouse polyclonal to BRD2

BRD2-IT1 Protein Vector (Human) (pPM-N-D-C-HA)

PV327464 500 ng Ask for price

BRD2-IT1 ORF Vector (Human) (pORF)

ORF016242 1.0 ug DNA Ask for price

BRD2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV674395 1.0 ug DNA
EUR 1355

BRD2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV674399 1.0 ug DNA
EUR 1355

BRD2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV674400 1.0 ug DNA
EUR 1355


EF008143 96 Tests
EUR 689

Human BRD2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Brd2 ORF Vector (Mouse) (pORF)

ORF039956 1.0 ug DNA
EUR 506

Brd2 ORF Vector (Mouse) (pORF)

ORF039957 1.0 ug DNA
EUR 506

Brd2 ORF Vector (Rat) (pORF)

ORF064136 1.0 ug DNA
EUR 506

BRD2 Protein Vector (Human) (pPB-C-His)

PV004241 500 ng
EUR 329

BRD2 Protein Vector (Human) (pPB-N-His)

PV004242 500 ng
EUR 329

BRD2 Protein Vector (Human) (pPM-C-His)

PV004244 500 ng
EUR 329

BRD2 Protein Vector (Human) (pPB-His-MBP)

PV327458 500 ng
EUR 329

BRD2 Protein Vector (Human) (pPB-His-GST)

PV327459 500 ng
EUR 329

BRD2 Conjugated Antibody

C49970 100ul
EUR 397

BRD2 cloning plasmid

CSB-CL002800HU-10ug 10ug
EUR 812
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2511
  • Sequence: atgctgcaaaacgtgactccccacaataagctccctggggaagggaatgcagggttgctggggctgggcccagaagcagcagcaccagggaaaaggattcgaaaaccctctctcttgtatgagggctttgagagccccacaatggcttcggtgcctgctttgcaacttacccctg
  • Show more
Description: A cloning plasmid for the BRD2 gene.

anti- BRD2 antibody

FNab00946 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:200-1:1000
  • Immunogen: bromodomain containing 2
  • Uniprot ID: P25440
  • Gene ID: 6046
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against BRD2

BRD2 Polyclonal Antibody

ES11774-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against BRD2. This antibody is tested and validated for WB, ELISA, WB, ELISA

BRD2 Polyclonal Antibody

ES11774-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against BRD2. This antibody is tested and validated for WB, ELISA, WB, ELISA

BRD2 Polyclonal Antibody

ABP57923-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human BRD2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of BRD2 from Human. This BRD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BRD2 protein

BRD2 Polyclonal Antibody

ABP57923-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human BRD2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of BRD2 from Human. This BRD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BRD2 protein

BRD2 Polyclonal Antibody

ABP57923-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human BRD2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of BRD2 from Human. This BRD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BRD2 protein

BRD2 Rabbit pAb

A18229-100ul 100 ul
EUR 308

BRD2 Rabbit pAb

A18229-200ul 200 ul
EUR 459

BRD2 Rabbit pAb

A18229-20ul 20 ul
EUR 183

BRD2 Rabbit pAb

A18229-50ul 50 ul
EUR 223

BRD2 Rabbit pAb

A16241-100ul 100 ul
EUR 308

BRD2 Rabbit pAb

A16241-200ul 200 ul
EUR 459

BRD2 Rabbit pAb

A16241-20ul 20 ul
EUR 183

BRD2 Rabbit pAb

A16241-50ul 50 ul
EUR 223

BRD2 Rabbit pAb

A2233-100ul 100 ul
EUR 308

BRD2 Rabbit pAb

A2233-200ul 200 ul
EUR 459

BRD2 Rabbit pAb

A2233-20ul 20 ul Ask for price

BRD2 Rabbit pAb

A2233-50ul 50 ul Ask for price

BRD2 Blocking Peptide

EUR 153

BRD2 polyclonal antibody

EUR 251

BRD2 Blocking Peptide

DF12857-BP 1mg
EUR 195

Anti-BRD2 antibody

PAab00946 100 ug
EUR 355

Anti-BRD2 antibody

STJ29878 100 µl
EUR 277
Description: This gene encodes a transcriptional regulator that belongs to the BET (bromodomains and extra terminal domain) family of proteins. This protein associates with transcription complexes and with acetylated chromatin during mitosis, and it selectively binds to the acetylated lysine-12 residue of histone H4 via its two bromodomains. The gene maps to the major histocompatability complex (MHC) class II region on chromosome 6p21.3, but sequence comparison suggests that the protein is not involved in the immune response. This gene has been implicated in juvenile myoclonic epilepsy, a common form of epilepsy that becomes apparent in adolescence. Multiple alternatively spliced variants have been described for this gene.

Anti-BRD2 antibody

STJ11100186 100 µl
EUR 277
Description: This gene encodes a transcriptional regulator that belongs to the BET (bromodomains and extra terminal domain) family of proteins. This protein associates with transcription complexes and with acetylated chromatin during mitosis, and it selectively binds to the acetylated lysine-12 residue of histone H4 via its two bromodomains. The gene maps to the major histocompatability complex (MHC) class II region on chromosome 6p21.3, but sequence comparison suggests that the protein is not involved in the immune response. This gene has been implicated in juvenile myoclonic epilepsy, a common form of epilepsy that becomes apparent in adolescence. Multiple alternatively spliced variants have been described for this gene.

Anti-BRD2 antibody

STJ118693 100 µl
EUR 277

Anti-BRD2 antibody

STJ192932 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to BRD2

Anti-BRD2 (3D10)

YF-MA10786 100 ug
EUR 363
Description: Mouse monoclonal to BRD2

Antibody for Human BRD2 (pSer37)

SPC-925D 0.1ml
EUR 354
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is unconjugated.

Antibody for Human BRD2 (pSer37)

SPC-925D-A390 0.1ml
EUR 401
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 390.

Antibody for Human BRD2 (pSer37)

SPC-925D-A488 0.1ml
EUR 400
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 488.

Antibody for Human BRD2 (pSer37)

SPC-925D-A565 0.1ml
EUR 400
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 565.

Antibody for Human BRD2 (pSer37)

SPC-925D-A594 0.1ml
EUR 400
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 594.

Antibody for Human BRD2 (pSer37)

SPC-925D-A633 0.1ml
EUR 400
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 633.

Antibody for Human BRD2 (pSer37)

SPC-925D-A655 0.1ml
EUR 400
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 655.

Antibody for Human BRD2 (pSer37)

SPC-925D-A680 0.1ml
EUR 400
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 680.

Antibody for Human BRD2 (pSer37)

SPC-925D-A700 0.1ml
EUR 400
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 700.

Antibody for Human BRD2 (pSer37)

SPC-925D-ALP 0.1ml
EUR 394
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Alkaline Phosphatase.

Antibody for Human BRD2 (pSer37)

SPC-925D-APC 0.1ml
EUR 399
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to APC .

Antibody for Human BRD2 (pSer37)

SPC-925D-APCCY7 0.1ml
EUR 471
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to APC/Cy7.

Antibody for Human BRD2 (pSer37)

SPC-925D-BI 0.1ml
EUR 396
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Biotin.

Antibody for Human BRD2 (pSer37)

SPC-925D-DY350 0.1ml
EUR 475
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 350.

Antibody for Human BRD2 (pSer37)

SPC-925D-DY405 0.1ml
EUR 452
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 405.

Antibody for Human BRD2 (pSer37)

SPC-925D-DY488 0.1ml
EUR 432
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 488.

Antibody for Human BRD2 (pSer37)

SPC-925D-DY594 0.1ml
EUR 436
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 594.

Antibody for Human BRD2 (pSer37)

SPC-925D-DY633 0.1ml
EUR 426
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 633.

Antibody for Human BRD2 (pSer37)

SPC-925D-FITC 0.1ml
EUR 392
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to FITC.

Antibody for Human BRD2 (pSer37)

SPC-925D-HRP 0.1ml
EUR 388
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to HRP.

Antibody for Human BRD2 (pSer37)

SPC-925D-P594 0.1ml
EUR 407
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to PE/ATTO 594.

Antibody for Human BRD2 (pSer37)

SPC-925D-PCP 0.1ml
EUR 399
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to PerCP.

Antibody for Human BRD2 (pSer37)

SPC-925D-RPE 0.1ml
EUR 397
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to RPE .

Antibody for Human BRD2 (pSer37)

SPC-925D-STR 0.1ml
EUR 398
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Streptavidin.

Human Adult cDNA Tissue: Lung

HA-152 10 rxn
EUR 415

Human Adult cDNA Tissue: Skin

HA-218 10 rxn
EUR 415

Human Adult cDNA Tissue: Testis

HA-260 10 rxn
EUR 415

BRD2-IT1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV719827 1.0 ug DNA Ask for price

BRD2-IT1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV719828 1.0 ug DNA Ask for price

BRD2-IT1 Protein Vector (Human) (pPB-C-His)

PV064965 500 ng Ask for price

BRD2-IT1 Protein Vector (Human) (pPB-N-His)

PV064966 500 ng Ask for price

BRD2-IT1 Protein Vector (Human) (pPM-C-His)

PV064968 500 ng Ask for price

BRD2-IT1 Protein Vector (Human) (pPB-His-MBP)

PV327462 500 ng Ask for price

BRD2-IT1 Protein Vector (Human) (pPB-His-GST)

PV327463 500 ng Ask for price

Polyclonal BRD2 polyclonal antibody

APR00374G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal BRD2 polyclonal antibody

APR00447G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal BRD2 Antibody (Center)

APR06057G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 (Center). This antibody is tested and proven to work in the following applications:

Rat BRD2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BRD2 protein (His tag)

80R-4011 100 ug
EUR 349
Description: Recombinant Human BRD2 protein

Mouse BRD2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-BRD2 Plasmid

PVTB00811 2 ug
EUR 356

BRD2 sgRNA CRISPR Lentivector set (Human)

K0194001 3 x 1.0 ug
EUR 339

BRD2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV674397 1.0 ug DNA
EUR 1413

BRD2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV674398 1.0 ug DNA
EUR 1413

BRD2 Protein Vector (Rat) (pPB-C-His)

PV256542 500 ng
EUR 1166

BRD2 Protein Vector (Rat) (pPB-N-His)

PV256543 500 ng
EUR 1166

BRD2 Protein Vector (Rat) (pPM-C-His)

PV256545 500 ng
EUR 1166

BRD2 Protein Vector (Mouse) (pPB-C-His)

PV159822 500 ng
EUR 1065

BRD2 Protein Vector (Mouse) (pPB-N-His)

PV159823 500 ng
EUR 1065

BRD2 Protein Vector (Mouse) (pPM-C-His)

PV159825 500 ng
EUR 1065

BRD2 Protein Vector (Mouse) (pPB-C-His)

PV159826 500 ng
EUR 1065

BRD2 Protein Vector (Mouse) (pPB-N-His)

PV159827 500 ng
EUR 1065

BRD2 Protein Vector (Mouse) (pPM-C-His)

PV159829 500 ng
EUR 1065

BRD2 Protein Vector (Human) (pPM-N-D-C-His)

PV327461 500 ng
EUR 329

Hyaluronic Acid (HA) ELISA Kit

DLR-HA-Ge-48T 48T
EUR 469
  • Should the Hyaluronic Acid (HA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Hyaluronic Acid (HA) in samples from serum, plasma or other biological fluids.

Hyaluronic Acid (HA) ELISA Kit

DLR-HA-Ge-96T 96T
EUR 608
  • Should the Hyaluronic Acid (HA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Hyaluronic Acid (HA) in samples from serum, plasma or other biological fluids.

General Hyaluronic Acid (HA) ELISA Kit

RD-HA-Ge-48Tests 48 Tests
EUR 467

General Hyaluronic Acid (HA) ELISA Kit

RD-HA-Ge-96Tests 96 Tests
EUR 646

General Hyaluronic Acid (HA) ELISA Kit

RDR-HA-Ge-48Tests 48 Tests
EUR 488

General Hyaluronic Acid (HA) ELISA Kit

RDR-HA-Ge-96Tests 96 Tests
EUR 676

Human Bromodomain-Containing Protein 2 (BRD2) Protein

  • EUR 481.00
  • EUR 230.00
  • EUR 1330.00
  • EUR 551.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

BRD2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0194002 1.0 ug DNA
EUR 154

BRD2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0194003 1.0 ug DNA
EUR 154

BRD2-HA Lentiviral Vector Human