March 7, 2021



To Order Contact us:

ApoBEC3F antibody

70R-4925 50 ug
EUR 467
Description: Rabbit polyclonal ApoBEC3F antibody raised against the C terminal of APOBEC3F


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Apobec3f sgRNA CRISPR Lentivector set (Rat)

K7159401 3 x 1.0 ug
EUR 339

APOBEC3F sgRNA CRISPR Lentivector set (Human)

K0105901 3 x 1.0 ug
EUR 339

Apobec3f sgRNA CRISPR Lentivector (Rat) (Target 1)

K7159402 1.0 ug DNA
EUR 154

Apobec3f sgRNA CRISPR Lentivector (Rat) (Target 2)

K7159403 1.0 ug DNA
EUR 154

Apobec3f sgRNA CRISPR Lentivector (Rat) (Target 3)

K7159404 1.0 ug DNA
EUR 154

APOBEC3F sgRNA CRISPR Lentivector (Human) (Target 1)

K0105902 1.0 ug DNA
EUR 154

APOBEC3F sgRNA CRISPR Lentivector (Human) (Target 2)

K0105903 1.0 ug DNA
EUR 154

APOBEC3F sgRNA CRISPR Lentivector (Human) (Target 3)

K0105904 1.0 ug DNA
EUR 154

Apobec3f sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7159405 3 x 1.0 ug
EUR 376

APOBEC3F sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0105905 3 x 1.0 ug
EUR 376

APOBEC3F Polyclonal Antibody

30420-100ul 100ul
EUR 252

APOBEC3F Polyclonal Antibody

30420-50ul 50ul
EUR 187

APOBEC3F Polyclonal Antibody

30003-100ul 100ul
EUR 252

APOBEC3F Polyclonal Antibody

30003-50ul 50ul
EUR 187

ApoBEC3F Blocking Peptide

33R-1538 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of APOBEC3F antibody, catalog no. 70R-4925

ApoBEC3F Blocking Peptide

33R-6157 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of APOBEC3F antibody, catalog no. 70R-4923

ApoBEC3F Blocking Peptide

33R-6629 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of APOBEC3F antibody, catalog no. 70R-4815


  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against APOBEC3D/APOBEC3F. Recognizes APOBEC3D/APOBEC3F from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000


EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against APOBEC3D/APOBEC3F. Recognizes APOBEC3D/APOBEC3F from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100


CSB-PA448693-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against APOBEC3D/APOBEC3F. Recognizes APOBEC3D/APOBEC3F from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100


abx330594-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.


  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

APOBEC3F cloning plasmid

CSB-CL816878HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1122
  • Sequence: atgaagcctcacttcagaaacacagtggagcgaatgtatcgagacacattctcctacaacttttataatagacccatcctttctcgtcggaataccgtctggctgtgctacgaagtgaaaacaaagggtccctcaaggccccgtttggacgcaaagatctttcgaggccaggtgt
  • Show more
Description: A cloning plasmid for the APOBEC3F gene.

APOBEC3F Rabbit pAb

A2507-100ul 100 ul
EUR 308

APOBEC3F Rabbit pAb

A2507-200ul 200 ul
EUR 459

APOBEC3F Rabbit pAb

A2507-20ul 20 ul
EUR 183

APOBEC3F Rabbit pAb

A2507-50ul 50 ul
EUR 223

APOBEC3F Rabbit pAb

A17269-100ul 100 ul
EUR 308

APOBEC3F Rabbit pAb

A17269-200ul 200 ul
EUR 459

APOBEC3F Rabbit pAb

A17269-20ul 20 ul
EUR 183

APOBEC3F Rabbit pAb

A17269-50ul 50 ul
EUR 223

Anti-APOBEC3F antibody

STJ119417 100 µl
EUR 277
Description: This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. Alternatively spliced transcript variants encoding different isoforms have been identified.

Anti-APOBEC3F antibody

STJ22650 100 µl
EUR 277
Description: This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. Alternatively spliced transcript variants encoding different isoforms have been identified.


YF-PA26963 50 ul
EUR 334
Description: Mouse polyclonal to Anti-APOBEC3F

Apobec3f sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7159406 1.0 ug DNA
EUR 167

Apobec3f sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7159407 1.0 ug DNA
EUR 167

Apobec3f sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7159408 1.0 ug DNA
EUR 167

APOBEC3F sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0105906 1.0 ug DNA
EUR 167

APOBEC3F sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0105907 1.0 ug DNA
EUR 167

APOBEC3F sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0105908 1.0 ug DNA
EUR 167

APOBEC3F Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against APOBEC3F. Recognizes APOBEC3F from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

APOBEC3F Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against APOBEC3F. Recognizes APOBEC3F from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

APOBEC3F Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against APOBEC3F. Recognizes APOBEC3F from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human APOBEC3F shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

APOBEC3F Polyclonal Conjugated Antibody

C30003 100ul
EUR 397

APOBEC3F Polyclonal Conjugated Antibody

C30420 100ul
EUR 397

APOBEC3F Recombinant Protein (Human)

RP001564 100 ug Ask for price

Cas9 monoclonal antibody [Clone 7A9]

CAS9-AB-2 25 ug
EUR 204
  • Category: Cas9

A549 / Cas9 (Puro) Stable Cell Line

SC043-Cas9-Puro 2 x 106 cell/ml x 1ml
EUR 1058
Description: Cas9 expression stable cell line with Puromycin marker in A549 human lung cancer cells.

Hela / Cas9 (Bad) Stable Cell Line

SC045-Cas9-Bsd 2 x 106 cell/ml x 1ml
EUR 1058
Description: Cas9 expression stable cell line with Blasticidin resistance in Hela human cervical cancer cells.

APOBEC3F ORF Vector (Human) (pORF)

ORF000522 1.0 ug DNA
EUR 95

APOBEC3F ELISA Kit (Human) (OKCA01204)

OKCA01204 96 Wells
EUR 846
Description: Description of target: DNA deaminase (cytidine deaminase) which acts as an inhibitor of retrovirus replication and retrotransposon mobility via deaminase-dependent and -independent mechanisms. Exhibits antiviral activity against vif-deficient HIV-1. After the penetration of retroviral nucleocapsids into target cells of infection and the initiation of reverse transcription, it can induce the conversion of cytosine to uracil in the minus-sense single-strand viral DNA, leading to G-to-A hypermutations in the subsequent plus-strand viral DNA. The resultant detrimental levels of mutations in the proviral genome, along with a deamination-independent mechanism that works prior to the proviral integration, together exert efficient antiretroviral effects in infected target cells. Selectively targets single-stranded DNA and does not deaminate double-stranded DNA or single- or double-stranded RNA. Exhibits antiviral activity also against hepatitis B virus (HBV), equine infectious anemia virus (EIAV), xenotropic MuLV-related virus (XMRV) and simian foamy virus (SFV) and may inhibit the mobility of LTR and non-LTR retrotransposons. May also play a role in the epigenetic regulation of gene expression through the process of active DNA demethylation.1;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 3.9 pg/mL

A549 / Cas9 (GFP-Puro) Stable Cell Line

SC043-Cas9-GP 2 x 106 cell/ml x 1ml
EUR 1500
Description: Cas9 expression stable cell line with GFP-Puromycin fusion dual marker in A549 human lung cancer cells.

A549 / Cas9 (RFP-Puro) Stable Cell Line

SC043-Cas9-RP 2 x 106 cell/ml x 1ml
EUR 1500
Description: Cas9 expression stable cell line with RFP-Puromycin fusion dual marker in A549 human lung cancer cells.

Cas9 RT-PCR Primer Set (50ul at 5uM for each primer set)

CAS9-PR-1 50 reactions
EUR 153
  • Category: Cas9

APOBEC3F Protein Vector (Human) (pPB-His-MBP)

PV322846 500 ng
EUR 329

APOBEC3F Protein Vector (Human) (pPB-His-GST)

PV322847 500 ng
EUR 329

APOBEC3F Protein Vector (Human) (pPB-C-His)

PV002085 500 ng
EUR 329

APOBEC3F Protein Vector (Human) (pPB-N-His)

PV002086 500 ng
EUR 329

APOBEC3F Protein Vector (Human) (pPM-C-HA)

PV002087 500 ng
EUR 329

APOBEC3F Protein Vector (Human) (pPM-C-His)

PV002088 500 ng
EUR 329

Apobec3f 3'UTR Luciferase Stable Cell Line

TU200764 1.0 ml Ask for price

Apobec3f 3'UTR GFP Stable Cell Line

TU250764 1.0 ml Ask for price

APOBEC3F 3'UTR GFP Stable Cell Line

TU050964 1.0 ml
EUR 1394

APOBEC3F 3'UTR Luciferase Stable Cell Line

TU000964 1.0 ml
EUR 1394

APOBEC3F Protein Vector (Human) (pPM-N-D-C-HA)

PV322848 500 ng
EUR 552

APOBEC3F Protein Vector (Human) (pPM-N-D-C-His)

PV322849 500 ng
EUR 552

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

Apolipoprotein B mRNA Editing Enzyme Catalytic Subunit 3F (APOBEC3F) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Apolipoprotein B mRNA Editing Enzyme Catalytic Subunit 3F (APOBEC3F) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human DNA dC- >dU- editing enzyme APOBEC- 3F, APOBEC3F ELISA KIT

ELI-24663h 96 Tests
EUR 824

Human DNA dC->dU-editing enzyme APOBEC-3F(APOBEC3F) ELISA kit

CSB-EL001925HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human DNA dC->dU-editing enzyme APOBEC-3F (APOBEC3F) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human DNA dC->dU-editing enzyme APOBEC-3F(APOBEC3F) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human DNA dC->dU-editing enzyme APOBEC-3F(APOBEC3F) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Apolipoprotein B mRNA Editing Enzyme Catalytic Subunit 3F (APOBEC3F) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Apolipoprotein B mRNA Editing Enzyme Catalytic Subunit 3F (APOBEC3F) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Apolipoprotein B mRNA Editing Enzyme Catalytic Subunit 3F (APOBEC3F) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Scrambled sgRNA CRISPR/Cas9 All-in-One Lentivector

K010 1.0 ug
EUR 154

CRISPR-Cas9 Antibody

48200-100ul 100ul
EUR 333

CRISPR-Cas9 Antibody

48200-50ul 50ul
EUR 239

TDOR sgRNA CRISPR/Cas9 All-in-One Lentivector set ()

K9000805 3 x 1.0 ug
EUR 376

CRISPR-Associated Endonuclease Cas9/Csn1 (Cas9) Antibody

abx340123-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

pAc-sgRNA-Cas9 vector

PVT12154 2 ug
EUR 352

CRISPR-Cas9 SP Antibody

49498-100ul 100ul
EUR 333

CRISPR-Cas9 SP Antibody

49498-50ul 50ul
EUR 239

Anti-CRISPR Cas9 antibody

STJ120286 100 µl
EUR 526

Otor sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6034705 3 x 1.0 ug
EUR 376

RGD1561282 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6034805 3 x 1.0 ug
EUR 376

Serpinb9e sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6034905 3 x 1.0 ug
EUR 376

RGD1564324 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6035005 3 x 1.0 ug
EUR 376

Dmrt3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6035105 3 x 1.0 ug
EUR 376

RGD1566239 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6035205 3 x 1.0 ug
EUR 376

RGD1565410 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6035305 3 x 1.0 ug
EUR 376

RGD1310212 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6035405 3 x 1.0 ug
EUR 376

RGD1306008 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6035505 3 x 1.0 ug
EUR 376

RGD1559804 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6035605 3 x 1.0 ug
EUR 376

RGD1565611 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6035705 3 x 1.0 ug
EUR 376

Hbe1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6035805 3 x 1.0 ug
EUR 376

B3gnt3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6035905 3 x 1.0 ug
EUR 376

RGD1560324 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6036005 3 x 1.0 ug
EUR 376

RGD1307722 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6036105 3 x 1.0 ug
EUR 376

Cecr5 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6036205 3 x 1.0 ug
EUR 376

Akr1cl1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6036305 3 x 1.0 ug
EUR 376

Adh6a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6036405 3 x 1.0 ug
EUR 376

RGD1563669 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6036505 3 x 1.0 ug
EUR 376

RGD1565236 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6036605 3 x 1.0 ug
EUR 376

Snx12 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6036705 3 x 1.0 ug
EUR 376

RGD1564163 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6036805 3 x 1.0 ug
EUR 376

RGD1559683 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6036905 3 x 1.0 ug
EUR 376

RGD1565784 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6037005 3 x 1.0 ug
EUR 376

RGD1565498 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6037105 3 x 1.0 ug
EUR 376