APOBEC3F sgRNA CRISPR/Cas9

APOBEC3F sgRNA CRISPR/Cas9 

To Order Contact us: bjorn@lembcke.dk

ApoBEC3F antibody
70R-4815	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal ApoBEC3F antibody raised against the middle region of APOBEC3F

ApoBEC3F antibody
70R-4923	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal ApoBEC3F antibody raised against the N terminal of APOBEC3F

ApoBEC3F antibody
70R-4925	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal ApoBEC3F antibody raised against the C terminal of APOBEC3F

APOBEC3F siRNA
20-abx907825	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Apobec3f sgRNA CRISPR Lentivector (Rat) (Target 1)
K7159402	ABM	1.0 ug DNA	EUR 154

Apobec3f sgRNA CRISPR Lentivector (Rat) (Target 2)
K7159403	ABM	1.0 ug DNA	EUR 154

Apobec3f sgRNA CRISPR Lentivector (Rat) (Target 3)
K7159404	ABM	1.0 ug DNA	EUR 154

APOBEC3F sgRNA CRISPR Lentivector (Human) (Target 1)
K0105902	ABM	1.0 ug DNA	EUR 154

APOBEC3F sgRNA CRISPR Lentivector (Human) (Target 2)
K0105903	ABM	1.0 ug DNA	EUR 154

APOBEC3F sgRNA CRISPR Lentivector (Human) (Target 3)
K0105904	ABM	1.0 ug DNA	EUR 154

Apobec3f sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7159405	ABM	3 x 1.0 ug	EUR 376

APOBEC3F sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0105905	ABM	3 x 1.0 ug	EUR 376

APOBEC3F Polyclonal Antibody
30420-100ul	SAB	100ul	EUR 252

APOBEC3F Polyclonal Antibody
30420-50ul	SAB	50ul	EUR 187

APOBEC3F Polyclonal Antibody
30003-100ul	SAB	100ul	EUR 252

APOBEC3F Polyclonal Antibody
30003-50ul	SAB	50ul	EUR 187

ApoBEC3F Blocking Peptide
33R-1538	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of APOBEC3F antibody, catalog no. 70R-4925

ApoBEC3F Blocking Peptide
33R-6157	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of APOBEC3F antibody, catalog no. 70R-4923

ApoBEC3F Blocking Peptide
33R-6629	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of APOBEC3F antibody, catalog no. 70R-4815

APOBEC3D/APOBEC3F Antibody
1-CSB-PA000904	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against APOBEC3D/APOBEC3F. Recognizes APOBEC3D/APOBEC3F from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

APOBEC3D/APOBEC3F Antibody
CSB-PA448693-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against APOBEC3D/APOBEC3F. Recognizes APOBEC3D/APOBEC3F from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

APOBEC3D/APOBEC3F Antibody
CSB-PA448693-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against APOBEC3D/APOBEC3F. Recognizes APOBEC3D/APOBEC3F from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

APOBEC3D / APOBEC3F Antibody
abx330594-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

APOBEC3D / APOBEC3F Antibody
20-abx325084	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

APOBEC3F cloning plasmid
CSB-CL816878HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1122 Sequence: atgaagcctcacttcagaaacacagtggagcgaatgtatcgagacacattctcctacaacttttataatagacccatcctttctcgtcggaataccgtctggctgtgctacgaagtgaaaacaaagggtccctcaaggccccgtttggacgcaaagatctttcgaggccaggtgt Show more
Description: A cloning plasmid for the APOBEC3F gene.

APOBEC3F Rabbit pAb
A2507-100ul	Abclonal	100 ul	EUR 308

APOBEC3F Rabbit pAb
A2507-200ul	Abclonal	200 ul	EUR 459

APOBEC3F Rabbit pAb
A2507-20ul	Abclonal	20 ul	EUR 183

APOBEC3F Rabbit pAb
A2507-50ul	Abclonal	50 ul	EUR 223

APOBEC3F Rabbit pAb
A17269-100ul	Abclonal	100 ul	EUR 308

APOBEC3F Rabbit pAb
A17269-200ul	Abclonal	200 ul	EUR 459

APOBEC3F Rabbit pAb
A17269-20ul	Abclonal	20 ul	EUR 183

APOBEC3F Rabbit pAb
A17269-50ul	Abclonal	50 ul	EUR 223

anti-Anti-APOBEC3F
YF-PA26963	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Anti-APOBEC3F

Anti-APOBEC3F antibody
STJ119417	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. Alternatively spliced transcript variants encoding different isoforms have been identified.

Anti-APOBEC3F antibody
STJ22650	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. Alternatively spliced transcript variants encoding different isoforms have been identified.

Apobec3f sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7159406	ABM	1.0 ug DNA	EUR 167

Apobec3f sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7159407	ABM	1.0 ug DNA	EUR 167

Apobec3f sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7159408	ABM	1.0 ug DNA	EUR 167

APOBEC3F sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0105906	ABM	1.0 ug DNA	EUR 167

APOBEC3F sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0105907	ABM	1.0 ug DNA	EUR 167

APOBEC3F sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0105908	ABM	1.0 ug DNA	EUR 167

APOBEC3F Antibody, HRP conjugated
1-CSB-PA816878LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against APOBEC3F. Recognizes APOBEC3F from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

APOBEC3F Antibody, FITC conjugated
1-CSB-PA816878LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against APOBEC3F. Recognizes APOBEC3F from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

APOBEC3F Antibody, Biotin conjugated
1-CSB-PA816878LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against APOBEC3F. Recognizes APOBEC3F from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human APOBEC3F shRNA Plasmid
20-abx966245	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

APOBEC3F Polyclonal Conjugated Antibody
C30003	SAB	100ul	EUR 397

APOBEC3F Polyclonal Conjugated Antibody
C30420	SAB	100ul	EUR 397

APOBEC3F Recombinant Protein (Human)
RP001564	ABM	100 ug	Ask for price

Cas9 monoclonal antibody [Clone 7A9]
CAS9-AB-2	SBI	25 ug	EUR 204
Category: Cas9

A549 / Cas9 (Puro) Stable Cell Line
SC043-Cas9-Puro	GenTarget	2 x 106 cell/ml x 1ml	EUR 1058
Description: Cas9 expression stable cell line with Puromycin marker in A549 human lung cancer cells.

Hela / Cas9 (Bad) Stable Cell Line
SC045-Cas9-Bsd	GenTarget	2 x 106 cell/ml x 1ml	EUR 1058
Description: Cas9 expression stable cell line with Blasticidin resistance in Hela human cervical cancer cells.

APOBEC3F ORF Vector (Human) (pORF)
ORF000522	ABM	1.0 ug DNA	EUR 95

APOBEC3F ELISA Kit (Human) (OKCA01204)
OKCA01204	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: DNA deaminase (cytidine deaminase) which acts as an inhibitor of retrovirus replication and retrotransposon mobility via deaminase-dependent and -independent mechanisms. Exhibits antiviral activity against vif-deficient HIV-1. After the penetration of retroviral nucleocapsids into target cells of infection and the initiation of reverse transcription, it can induce the conversion of cytosine to uracil in the minus-sense single-strand viral DNA, leading to G-to-A hypermutations in the subsequent plus-strand viral DNA. The resultant detrimental levels of mutations in the proviral genome, along with a deamination-independent mechanism that works prior to the proviral integration, together exert efficient antiretroviral effects in infected target cells. Selectively targets single-stranded DNA and does not deaminate double-stranded DNA or single- or double-stranded RNA. Exhibits antiviral activity also against hepatitis B virus (HBV), equine infectious anemia virus (EIAV), xenotropic MuLV-related virus (XMRV) and simian foamy virus (SFV) and may inhibit the mobility of LTR and non-LTR retrotransposons. May also play a role in the epigenetic regulation of gene expression through the process of active DNA demethylation.1;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 3.9 pg/mL

A549 / Cas9 (GFP-Puro) Stable Cell Line
SC043-Cas9-GP	GenTarget	2 x 106 cell/ml x 1ml	EUR 1500
Description: Cas9 expression stable cell line with GFP-Puromycin fusion dual marker in A549 human lung cancer cells.

A549 / Cas9 (RFP-Puro) Stable Cell Line
SC043-Cas9-RP	GenTarget	2 x 106 cell/ml x 1ml	EUR 1500
Description: Cas9 expression stable cell line with RFP-Puromycin fusion dual marker in A549 human lung cancer cells.

Cas9 RT-PCR Primer Set (50ul at 5uM for each primer set)
CAS9-PR-1	SBI	50 reactions	EUR 153
Category: Cas9

APOBEC3F 3'UTR Luciferase Stable Cell Line
TU000964	ABM	1.0 ml	EUR 1394

Apobec3f 3'UTR Luciferase Stable Cell Line
TU200764	ABM	1.0 ml	Ask for price

Apobec3f 3'UTR GFP Stable Cell Line
TU250764	ABM	1.0 ml	Ask for price

APOBEC3F 3'UTR GFP Stable Cell Line
TU050964	ABM	1.0 ml	EUR 1394

APOBEC3F Protein Vector (Human) (pPB-His-MBP)
PV322846	ABM	500 ng	EUR 329

APOBEC3F Protein Vector (Human) (pPB-His-GST)
PV322847	ABM	500 ng	EUR 329

APOBEC3F Protein Vector (Human) (pPB-C-His)
PV002085	ABM	500 ng	EUR 329

APOBEC3F Protein Vector (Human) (pPB-N-His)
PV002086	ABM	500 ng	EUR 329

APOBEC3F Protein Vector (Human) (pPM-C-HA)
PV002087	ABM	500 ng	EUR 329

APOBEC3F Protein Vector (Human) (pPM-C-His)
PV002088	ABM	500 ng	EUR 329

APOBEC3F Protein Vector (Human) (pPM-N-D-C-HA)
PV322848	ABM	500 ng	EUR 552

APOBEC3F Protein Vector (Human) (pPM-N-D-C-His)
PV322849	ABM	500 ng	EUR 552

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT	SBI	10 rxn	EUR 445
Category: Cas9

Apolipoprotein B mRNA Editing Enzyme Catalytic Subunit 3F (APOBEC3F) Antibody
20-abx006279	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Apolipoprotein B mRNA Editing Enzyme Catalytic Subunit 3F (APOBEC3F) Antibody
20-abx338722	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human DNA dC- >dU- editing enzyme APOBEC- 3F, APOBEC3F ELISA KIT
ELI-24663h	Lifescience Market	96 Tests	EUR 824

Human DNA dC->dU-editing enzyme APOBEC-3F(APOBEC3F) ELISA kit
CSB-EL001925HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human DNA dC->dU-editing enzyme APOBEC-3F (APOBEC3F) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human DNA dC->dU-editing enzyme APOBEC-3F(APOBEC3F) ELISA kit
1-CSB-EL001925HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human DNA dC->dU-editing enzyme APOBEC-3F(APOBEC3F) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Apolipoprotein B mRNA Editing Enzyme Catalytic Subunit 3F (APOBEC3F) Antibody (HRP)
20-abx335385	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Apolipoprotein B mRNA Editing Enzyme Catalytic Subunit 3F (APOBEC3F) Antibody (FITC)
20-abx335386	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Apolipoprotein B mRNA Editing Enzyme Catalytic Subunit 3F (APOBEC3F) Antibody (Biotin)
20-abx335387	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Scrambled sgRNA CRISPR/Cas9 All-in-One Lentivector
K010	ABM	1.0 ug	EUR 154

CRISPR-Cas9 Antibody
48200-100ul	SAB	100ul	EUR 333

CRISPR-Cas9 Antibody
48200-50ul	SAB	50ul	EUR 239

TDOR sgRNA CRISPR/Cas9 All-in-One Lentivector set ()
K9000805	ABM	3 x 1.0 ug	EUR 376

CRISPR-Associated Endonuclease Cas9/Csn1 (Cas9) Antibody
abx340123-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

pAc-sgRNA-Cas9 vector
PVT12154	Lifescience Market	2 ug	EUR 352

CRISPR-Cas9 SP Antibody
49498-100ul	SAB	100ul	EUR 333

CRISPR-Cas9 SP Antibody
49498-50ul	SAB	50ul	EUR 239

Anti-CRISPR Cas9 antibody
STJ120286	St John's Laboratory	100 µl	EUR 526

Otor sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6034705	ABM	3 x 1.0 ug	EUR 376

RGD1561282 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6034805	ABM	3 x 1.0 ug	EUR 376

Serpinb9e sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6034905	ABM	3 x 1.0 ug	EUR 376

RGD1564324 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6035005	ABM	3 x 1.0 ug	EUR 376

Dmrt3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6035105	ABM	3 x 1.0 ug	EUR 376

RGD1566239 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6035205	ABM	3 x 1.0 ug	EUR 376

RGD1565410 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6035305	ABM	3 x 1.0 ug	EUR 376

RGD1310212 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6035405	ABM	3 x 1.0 ug	EUR 376

RGD1306008 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6035505	ABM	3 x 1.0 ug	EUR 376

RGD1559804 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6035605	ABM	3 x 1.0 ug	EUR 376

APOBEC3F sgRNA CRISPR/Cas9