October 21, 2021

APOA1 CRISPR Knockout HepG2

APOA1 CRISPR Knockout HepG2 

To Order Contact us: bjorn@lembcke.dk

Human Apolipoprotein A1 (APOA1) ELISA Kit

DLR-APOA1-Hu-48T 48T
EUR 441
  • Should the Human Apolipoprotein A1 (APOA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein A1 (APOA1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Apolipoprotein A1 (APOA1) ELISA Kit

DLR-APOA1-Hu-96T 96T
EUR 570
  • Should the Human Apolipoprotein A1 (APOA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Apolipoprotein A1 (APOA1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Apolipoprotein A1 (APOA1) ELISA Kit

DLR-APOA1-Mu-48T 48T
EUR 450
  • Should the Mouse Apolipoprotein A1 (APOA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein A1 (APOA1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Apolipoprotein A1 (APOA1) ELISA Kit

DLR-APOA1-Mu-96T 96T
EUR 582
  • Should the Mouse Apolipoprotein A1 (APOA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Apolipoprotein A1 (APOA1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Apolipoprotein A1 (APOA1) ELISA Kit

DLR-APOA1-p-48T 48T
EUR 547
  • Should the Porcine Apolipoprotein A1 (APOA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Apolipoprotein A1 (APOA1) in samples from serum, plasma or other biological fluids.

Porcine Apolipoprotein A1 (APOA1) ELISA Kit

DLR-APOA1-p-96T 96T
EUR 715
  • Should the Porcine Apolipoprotein A1 (APOA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Apolipoprotein A1 (APOA1) in samples from serum, plasma or other biological fluids.

Rat Apolipoprotein A1 (APOA1) ELISA Kit

DLR-APOA1-Ra-48T 48T
EUR 467
  • Should the Rat Apolipoprotein A1 (APOA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein A1 (APOA1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Apolipoprotein A1 (APOA1) ELISA Kit

DLR-APOA1-Ra-96T 96T
EUR 605
  • Should the Rat Apolipoprotein A1 (APOA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Apolipoprotein A1 (APOA1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit Apolipoprotein A1 (APOA1) ELISA Kit

DLR-APOA1-Rb-48T 48T
EUR 467
  • Should the Rabbit Apolipoprotein A1 (APOA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rabbit Apolipoprotein A1 (APOA1) in samples from serum, plasma or other biological fluids.

Rabbit Apolipoprotein A1 (APOA1) ELISA Kit

DLR-APOA1-Rb-96T 96T
EUR 605
  • Should the Rabbit Apolipoprotein A1 (APOA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rabbit Apolipoprotein A1 (APOA1) in samples from serum, plasma or other biological fluids.

Monkey Apolipoprotein A1 (APOA1) ELISA Kit

DLR-APOA1-Si-48T 48T
EUR 576
  • Should the Monkey Apolipoprotein A1 (APOA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Monkey Apolipoprotein A1 (APOA1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Monkey Apolipoprotein A1 (APOA1) ELISA Kit

DLR-APOA1-Si-96T 96T
EUR 755
  • Should the Monkey Apolipoprotein A1 (APOA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Monkey Apolipoprotein A1 (APOA1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Apolipoprotein A1 (APOA1) ELISA Kit

RD-APOA1-Hu-48Tests 48 Tests
EUR 436

Human Apolipoprotein A1 (APOA1) ELISA Kit

RD-APOA1-Hu-96Tests 96 Tests
EUR 601

Mouse Apolipoprotein A1 (APOA1) ELISA Kit

RD-APOA1-Mu-48Tests 48 Tests
EUR 446

Mouse Apolipoprotein A1 (APOA1) ELISA Kit

RD-APOA1-Mu-96Tests 96 Tests
EUR 615

Porcine Apolipoprotein A1 (APOA1) ELISA Kit

RD-APOA1-p-48Tests 48 Tests
EUR 555

Porcine Apolipoprotein A1 (APOA1) ELISA Kit

RD-APOA1-p-96Tests 96 Tests
EUR 771

Rat Apolipoprotein A1 (APOA1) ELISA Kit

RD-APOA1-Ra-48Tests 48 Tests
EUR 465

Rat Apolipoprotein A1 (APOA1) ELISA Kit

RD-APOA1-Ra-96Tests 96 Tests
EUR 643

Rabbit Apolipoprotein A1 (APOA1) ELISA Kit

RD-APOA1-Rb-48Tests 48 Tests
EUR 465

Rabbit Apolipoprotein A1 (APOA1) ELISA Kit

RD-APOA1-Rb-96Tests 96 Tests
EUR 643

Monkey Apolipoprotein A1 (APOA1) ELISA Kit

RD-APOA1-Si-48Tests 48 Tests
EUR 587

Monkey Apolipoprotein A1 (APOA1) ELISA Kit

RD-APOA1-Si-96Tests 96 Tests
EUR 818

Human Apolipoprotein A1 (APOA1) ELISA Kit

RDR-APOA1-Hu-48Tests 48 Tests
EUR 455

Human Apolipoprotein A1 (APOA1) ELISA Kit

RDR-APOA1-Hu-96Tests 96 Tests
EUR 629

Mouse Apolipoprotein A1 (APOA1) ELISA Kit

RDR-APOA1-Mu-48Tests 48 Tests
EUR 465

Mouse Apolipoprotein A1 (APOA1) ELISA Kit

RDR-APOA1-Mu-96Tests 96 Tests
EUR 643

Porcine Apolipoprotein A1 (APOA1) ELISA Kit

RDR-APOA1-p-48Tests 48 Tests
EUR 580

Porcine Apolipoprotein A1 (APOA1) ELISA Kit

RDR-APOA1-p-96Tests 96 Tests
EUR 807

Rat Apolipoprotein A1 (APOA1) ELISA Kit

RDR-APOA1-Ra-48Tests 48 Tests
EUR 486

Rat Apolipoprotein A1 (APOA1) ELISA Kit

RDR-APOA1-Ra-96Tests 96 Tests
EUR 672

Rabbit Apolipoprotein A1 (APOA1) ELISA Kit

RDR-APOA1-Rb-48Tests 48 Tests
EUR 486

Rabbit Apolipoprotein A1 (APOA1) ELISA Kit

RDR-APOA1-Rb-96Tests 96 Tests
EUR 672

Monkey Apolipoprotein A1 (APOA1) ELISA Kit

RDR-APOA1-Si-48Tests 48 Tests
EUR 614

Monkey Apolipoprotein A1 (APOA1) ELISA Kit

RDR-APOA1-Si-96Tests 96 Tests
EUR 856

Human HepG2 (Hepatocellular Carcinoma) lysate

HCL-1211 100ug
EUR 238

Human HepG2 Whole Cell Lysate

LYSATE0029 200ug
EUR 150
Description: This cell lysate is prepared from human HepG2 using Boster's RIPA Lysis Buffer (AR0105) using a standard whole cell lysate protocol. The concentration was determined using the BCA assay process and then diluted using Dithiothreitol (DTT) and a reducing SDS sample loading buffer, heated for 5 minutes at 100˚C.

pGreenFire1- PPRE (HepG2 cell line)

TR101A-P >2 x 10^6 cells
EUR 3263
  • Category: Lentiviral Technology

HEP G2 Whole Cell Lysate (Hepatoblastoma cells)

HEPG2-100 100 ug
EUR 164

HEP G2 Whole Cell Lysate (Hepatoblastoma cells)

HEPG2-50 50 ug
EUR 128

HepG2 Cell Lysate (Human hepatoma cell line)

LF-R0017 200 ul
EUR 86
Description: HepG2 (Human hepatoma cell line) Whole Cell Lysate

pGreenFire1-LXRE in SREBP1c (HepG2 cell line)

TR100A-P >2 x 10^6 cells
EUR 3263
  • Category: Lentiviral Technology

pGreenFire1-LXRE in Cyp7A1(HepG2 cell line)

TR105A-P >2 x 10^6 cells
EUR 3263
  • Category: Lentiviral Technology

pGreenFire1-LXRE in ABCA1(HepG2 cell line)

TR106A-P >2 x 10^6 cells
EUR 3263
  • Category: Lentiviral Technology

pGreenFire1-LXRE in ABCG1(HepG2 cell line)

TR107A-P >2 x 10^6 cells
EUR 3263
  • Category: Lentiviral Technology

pGreenFire1-LXRE in ApoE(HepG2 cell line)

TR108A-P >2 x 10^6 cells
EUR 3263
  • Category: Lentiviral Technology

pGreenFire1-LXRE in CETP(HepG2 cell line)

TR109A-P >2 x 10^6 cells
EUR 3263
  • Category: Lentiviral Technology


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

APOA1 Antibody

BF0578 200ul
EUR 376
Description: APOA1 antibody detects endogenous levels of total APOA1.

APOA1 Protein

  • EUR 328.00
  • EUR 885.00
  • EUR 230.00
  • 100 ug
  • 1 mg
  • 20 ug
  • Shipped within 5-10 working days.

APOA1 Protein

  • EUR 328.00
  • EUR 1344.00
  • EUR 230.00
  • 100 ug
  • 1 mg
  • 20 ug
  • Shipped within 5-10 working days.

APOA1 protein

80R-4196 100 ul
EUR 349
Description: Recombinant Mouse APOA1 protein with His tag

APOA1 Antibody

ABD6264 100 ug
EUR 438

APOA1 Antibody

35570-100ul 100ul
EUR 252

APOA1 antibody

38197-100ul 100ul
EUR 252

ApoA1 antibody

10R-10374 100 ug
EUR 435
Description: Mouse monoclonal ApoA1 antibody

ApoA1 antibody

10R-10571 100 ug
EUR 349
Description: Mouse monoclonal ApoA1 antibody

ApoA1 antibody

10-A10 1 mg
EUR 176
Description: Mouse monoclonal ApoA1 antibody

ApoA1 protein

30R-2378 20 ug
EUR 148
Description: Purified recombinant Human ApoA1 protein

ApoA1 protein

30R-2379 20 ug
EUR 180
Description: Purified recombinant Rat ApoA1 protein

APOA1 Protein

30R-3414 1 mg
EUR 743
Description: Human Apolipoprotein A1

ApoA1 protein

30-1047S 100 ug
EUR 162
Description: Purified native Human ApoA1 protein

ApoA1 protein

30-1341 100 ug
EUR 325
Description: Purified native ApoA1 protein

APOA1 antibody

10R-3134 100 ul
EUR 349
Description: Mouse monoclonal APOA1 antibody

ApoA1 Antibody

24862-100ul 100ul
EUR 390

ApoA1 Antibody

25292-100ul 100ul
EUR 390

ApoA1 antibody

20R-1850 100 ug
EUR 673
Description: Rabbit polyclonal ApoA1 antibody

ApoA1 Antibody

EUR 316

ApoA1 Antibody

EUR 146

ApoA1 Antibody

EUR 316

ApoA1 Antibody

EUR 146

ApoA1 antibody

70R-12417 100 ug
EUR 403
Description: Rabbit polyclonal ApoA1 antibody

ApoA1 antibody

70R-12418 100 ug
EUR 403
Description: Rabbit polyclonal ApoA1 antibody

ApoA1 antibody

70R-13840 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal ApoA1 antibody

APOA1 antibody

70R-15769 50 ul
EUR 435
Description: Rabbit polyclonal APOA1 antibody

APOA1 Antibody

DF6264 200ul
EUR 304
Description: APOA1 Antibody detects endogenous levels of total APOA1.

APOA1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against APOA1. Recognizes APOA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

APOA1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against APOA1. Recognizes APOA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

APOA1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against APOA1. Recognizes APOA1 from Bovine, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

APOA1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against APOA1. Recognizes APOA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

APOA1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against APOA1. Recognizes APOA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

APOA1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against APOA1. Recognizes APOA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

pGreenFire1-LXRE in LXR alpha (HepG2 cell line)

TR102A-P >2 x 10^6 cells
EUR 3263
  • Category: Lentiviral Technology

Polyclonal ApoA1 Antibody

APG01938G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ApoA1 . This antibody is tested and proven to work in the following applications:

Polyclonal ApoA1 Antibody

APG01939G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Chicken that recognizes and binds to Human ApoA1 . This antibody is tested and proven to work in the following applications:

Polyclonal ApoA1 Antibody

APG01940G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ApoA1 . This antibody is tested and proven to work in the following applications:

APOA1 Blocking Peptide

BF0578-BP 1mg
EUR 195

APOA1 Conjugated Antibody

C35570 100ul
EUR 397

anti- APOA1 antibody

FNab00488 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:4000
  • IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: apolipoprotein A-I
  • Uniprot ID: P02647
  • Gene ID: 335
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against APOA1

APOA1 Rabbit pAb

A1129-100ul 100 ul
EUR 308

APOA1 Rabbit pAb

A1129-200ul 200 ul
EUR 459

APOA1 Rabbit pAb

A1129-20ul 20 ul
EUR 183

APOA1 Rabbit pAb

A1129-50ul 50 ul
EUR 223

APOA1 Polyclonal Antibody

A54336 100 µg
EUR 570.55
Description: The best epigenetics products

APOA1 Polyclonal Antibody

A55259 100 µg
EUR 570.55
Description: reagents widely cited

APOA1 Rabbit pAb

A14211-100ul 100 ul
EUR 308

APOA1 Rabbit pAb

A14211-200ul 200 ul
EUR 459

APOA1 Rabbit pAb

A14211-20ul 20 ul
EUR 183

APOA1 Rabbit pAb

A14211-50ul 50 ul
EUR 223

ApoA1 Antibody (NT)

EUR 327

APOA1 Blocking Peptide

DF6264-BP 1mg
EUR 195

APOA1 cloning plasmid

CSB-CL001913HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 804
  • Sequence: atgaaagctgcggtgctgaccttggccgtgctcttcctgacggggagccaggctcggcatttctggcagcaagatgaacccccccagagcccctgggatcgagtgaaggacctggccactgtgtacgtggatgtgctcaaagacagcggcagagactatgtgtcccagtttgaagg
  • Show more
Description: A cloning plasmid for the APOA1 gene.

anti-APOA1 (5F4F5)

LF-MA30163 100 ul
EUR 537
Description: Mouse Monoclonal to APOA1

Anti-APOA1 antibody

STJ72957 100 µg
EUR 359

Anti-APOA1 antibody

STJ73105 100 µg
EUR 359

Anti-APOA1 antibody

STJ400012 1 mg
EUR 446
Description: Apolipoprotein A1 (ApoA1) is a major component of the high-density lipoprotein complex (HDL or "good cholesterol"). ApoA1 helps to clear cholesterol from arteries. Decreased serum HDL cholesterol levels have been reported to correlate with increased risk of coronary artery disease. However, ApoA1 has been suggested as a better discrimination of coronary artery disease than HDL.

Anti-APOA1 antibody

STJ22644 100 µl
EUR 277
Description: This gene encodes apolipoprotein A-I, which is the major protein component of high density lipoprotein (HDL) in plasma. The encoded preproprotein is proteolytically processed to generate the mature protein, which promotes cholesterol efflux from tissues to the liver for excretion, and is a cofactor for lecithin cholesterolacyltransferase (LCAT), an enzyme responsible for the formation of most plasma cholesteryl esters. This gene is closely linked with two other apolipoprotein genes on chromosome 11. Defects in this gene are associated with HDL deficiencies, including Tangier disease, and with systemic non-neuropathic amyloidosis. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein.

Anti-APOA1 antibody

STJ116143 100 µl
EUR 277
Description: This gene encodes apolipoprotein A-I, which is the major protein component of high density lipoprotein (HDL) in plasma. The encoded preproprotein is proteolytically processed to generate the mature protein, which promotes cholesterol efflux from tissues to the liver for excretion, and is a cofactor for lecithin cholesterolacyltransferase (LCAT), an enzyme responsible for the formation of most plasma cholesteryl esters. This gene is closely linked with two other apolipoprotein genes on chromosome 11. Defects in this gene are associated with HDL deficiencies, including Tangier disease, and with systemic non-neuropathic amyloidosis. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein.

APOA1 CRISPR Knockout HepG2